Artículo Original
 
Detección de genes de resistencia a TYLCV-IL y TSWV en genotipos de tomate en Cuba
Detection of resistance genes to TYLCV-IL and TSWV in tomato genotypes in Cuba
 

iDHeidy González-Alvarez1Grupo de Fitopatología. Dirección de Sanidad Vegetal. Centro Nacional de Sanidad Agropecuaria (CENSA). Apartado 10. San José de las Lajas, Mayabeque, Cuba.

Yaniel Castro Reyes2Instituto Nacional de Ciencias Agrícolas (INCA). Carretera de Tapaste km 3½, San José de las Lajas, Mayabeque, Cuba.

Lidia Chang Sidorchuk1Grupo de Fitopatología. Dirección de Sanidad Vegetal. Centro Nacional de Sanidad Agropecuaria (CENSA). Apartado 10. San José de las Lajas, Mayabeque, Cuba.

iDYamila Martínez-Zubiaur1Grupo de Fitopatología. Dirección de Sanidad Vegetal. Centro Nacional de Sanidad Agropecuaria (CENSA). Apartado 10. San José de las Lajas, Mayabeque, Cuba. *✉:yamila@censa.edu.cu

 

1Grupo de Fitopatología. Dirección de Sanidad Vegetal. Centro Nacional de Sanidad Agropecuaria (CENSA). Apartado 10. San José de las Lajas, Mayabeque, Cuba.

2Instituto Nacional de Ciencias Agrícolas (INCA). Carretera de Tapaste km 3½, San José de las Lajas, Mayabeque, Cuba.

 

*Autor por correspondencia: Yamila Martínez-Zubiaur. E-mail: yamila@censa.edu.cu

 

RESUMEN

Los genes Ty.1, Ty.2 y Ty.3 para la resistencia a Tomato yellow leaf curl virus (TYLCV) y el SW5 para Tomato spotted wilt virus (TSWV), son los genes que más se han utilizado en los programas de mejoramiento genético de tomate. El estudio tuvo como objetivo determinar la presencia de estos genes en genotipos de tomate conservados en el banco de germoplasma del Instituto Nacional de Ciencias Agrícolas (INCA) de Cuba. En el estudio se utilizaron 12 cultivares a los que se les realizó la extracción de ADN y la amplificación de los genes se realizó por PCR con los cebadores específicos correspondientes. Se identificó la presencia de la banda relacionada con el patrón resistente del gen Ty.3 en tres de las muestras analizadas (201, 205, 210) y fue similar el resultado para el gen Ty.1 (201, 203, 205). El gen SW5 amplificó en dos de las muestras analizadas (205, 207). A partir de los resultados obtenidos se sugirió el uso del cultivar 205 en los programas de mejora genética teniendo en cuenta que presenta genes de resistencia para TYLCV y TSWV. Se confirma, además, la importancia del uso de marcadores moleculares para lograr el avance en la obtención de variedades con resistencia a las enfermedades de mayor impacto en la producción.

Palabras clave: 
genes de resistencia; Begomovirus; Orthotospovirus; pirimidización de genes.
 
ABSTRACT

The genes Ty.1, Ty.2, and Ty.3 for resistance to Tomato yellow leaf curl virus (TYLCV) and SW5 for Tomato spotted wilt virus (TSWV) are the most widely used in the tomato breeding programs. This study was aimed at determining the presence of these genes in tomato genotypes preserved in the germplasm bank of the National Institute of Agricultural Sciences (INCA), Cuba. The study used 12 cultivars from which DNA was extracted. Gene amplification was carried out by PCR with the corresponding specific primers. The presence of the band related to the resistant pattern of the Ty.3 gene was identified in 3 of the samples analyzed (201, 205, 210), being similar the result for the Ty.1 gene (201, 203, 205). The gene SW5 was amplified in 2 of the samples analyzed (205, 207). From the results obtained, it was suggested the use of the cultivar 205 in the genetic improvement programs, considering that it presents resistance genes for TYLCV and TSWV. It was also confirmed the importance of the use of molecular markers to achieve the advance in obtaining varieties resistant to the diseases of greater impact on production.

Key words: 
resistance genes; Begomovirus; Orthotospovirus; pirimidización of genes.
 
 
 
INTRODUCCIÓN

La productividad del cultivo de tomate (Solanum lycopersicum L.) se ve limitada por la incidencia de numerosas plagas y enfermedades (11. Sanches J. Generación de línea T-DNA de tomate (Solanum lycopersicum) para la identificación de mutantes de inserción alterados en la morfogénesis y el desarrollo vegetal. [Tesis de doctorado]. Universidad Politécnica de Valencia, Valencia, España. 2017.); el Begomovirus Tomato yellow leaf curl virus (TYLCV) y los Orthotospovirus (22. Peter J, Stuart G, Elliot J, Arcady R, Evelien M, Donald M, et al. Changes to virus taxonomy and the Statutes ratified bythe International Committee on Taxonomy of Viruses. Archives of Virology. 2020. https://doi.org/10.1007/s00705-020-04752-x ) Tomato spotted wilt virus (TSWV), Tomato chlorotic spotted virus (TCSV) y Grounud ring spotted virus (GRSV) son las entidades virales que provocan mayores pérdidas económicas a nivel mundial en el cultivo (33. Aragón OE, Rojas A, Laguna T. Identificación de cultivares de tomate con resistencia a begomovirus utilizando marcadores moleculares tipo SCAR y CAPS. Biotecnología Vegetal. 2012; 12(2): 67-76.,44. Ferrand L. Caracterización de aislamientos argentinos de Tomato spotted wilt virus que quiebran la resistencia mediada por el gen Tsw en Capsicum annuum L. [Tesis de doctorado]. Universidad Nacional de la Plata, La Plata, Argentina. 2017.).

En Cuba, desde su aparición en la década de los 80, la enfermedad ocasionada por TYLCV es la que mayores daños ocasiona en las producciones de tomate (55. Martínez Y, Martínez MA, Quiñones M, Miranda I, Holt J, Chancellor T. Estudio de factores que influyen en la epifitología del complejo mosca blanca-geminivirus, en la región oriental de Cuba. Rev. Protección Veg. 2009; 24(1): 47-50.). En los últimos años también se han visto afectados los rendimientos por la presencia de Orthotospovirus (TCSV) en el cultivo (66. Martínez-Zubiaur Y, Chang Sidorchuk L, González Álvarez H, Barboza Vargas N, González Arias G. First molecular evidence of Tomato chlorotic spot virus infecting Tomatoes in Cuba. Plant Disease. 2016; 100(9):1956.).

Una alternativa para contrarrestar estas enfermedades ha sido la búsqueda de fuentes de resistencia a estos patógenos. Para ello se implementó en el país un programa de mejora genética para la obtención de líneas o variedades, que presentaran un comportamiento resistente ante los efectos negativos provocados por TYLCV-IL (77. Gómez O, Piñón M, Martínez Y, Quiñones, Fonseca D, Laterrot H. Breeding for resistance to begomovirus in tropic-adapted tomato genotypes. Plant Breeding. 2004; 123: 275-279.).

Mediante el programa de mejora genética fue posible obtener el cultivar ‘Vyta’, con la introgresión del gen Ty.1 (88. Piñón M, Gómez O, Cornide MT. RFLP analysis of Cuban tomato breeding lines with resistance to Tomato yellow leaf curl virus. Acta Hort. 2005; 695:273-276.), a partir de la accesión LA 1969 de Solanum chilense (Dunal) Reiche, con características que permitieron su explotación comercial en todas las áreas productoras del país (77. Gómez O, Piñón M, Martínez Y, Quiñones, Fonseca D, Laterrot H. Breeding for resistance to begomovirus in tropic-adapted tomato genotypes. Plant Breeding. 2004; 123: 275-279.). En los últimos años, se han incluido en este programa introgresiones de los genes Ty.2, accesión B6013 de S. habrochaites S. Knapp & D.M. Spooner (99. Dueñas F, Álvarez M , Molina L, Arias Y. Identificación de los genes Ty-2 y Ty-3 de resistencia a Begomovirus y su grado de homocigosis en nuevas accesiones de tomate. Cultivos Tropicales. 2009; 30(1): 61-64.) y Ty.3 a partir de las accesiones LA2779 y LA1932 de Solanum chilense (1010. Dueñas F, Álvarez M, Moya C, Martínez Y. Identificación del gen Ty-3, de resistencia a Begomovirus, en accesiones de Solanum lycopersicum L. Cultivos Tropicales. 2011; 32(3): 42-45.) para conferir resistencia a TYLCV. Además, se ha trabajado en la obtención de cultivares que presenten diferentes combinaciones de los genes Ty.1, Ty.2 o Ty.3 para aumentar así la resistencia a Begomovirus (22. Peter J, Stuart G, Elliot J, Arcady R, Evelien M, Donald M, et al. Changes to virus taxonomy and the Statutes ratified bythe International Committee on Taxonomy of Viruses. Archives of Virology. 2020. https://doi.org/10.1007/s00705-020-04752-x ) y en la introgresión de fuentes de resistencia, tanto para TYLCV como para Orthotospovirus, en un mismo material vegetal mediante la pirimidización de genes. Esta alternativa se ha utilizado en función de lograr una resistencia más amplia y duradera (1111. Gómez O, Piñón M, Martínez Y. Pyramiding TYLCV and TSWV resistance genes in tomato genotypes. Rev. Protección Veg. 2015; 30(2): 161-164.).

En Cuba, la búsqueda constante de fuentes de resistencia a especies virales constituye una prioridad de todos los programas de mejora genética del cultivo del tomate que se ejecutan actualmente, debido a que una de las principales causas de sus pérdidas productivas es la presencia de los géneros virales Begomovirus y Orthotospovirus. Este trabajo tuvo como objetivo determinar la presencia de los genes Ty.1, Ty.3 y SW5 en genotipos de tomate conservados en el germoplasma del Instituto Nacional de Ciencias Agrícolas (INCA) para su uso en los programas de mejora genética.

MATERIALES Y MÉTODOS

Se analizaron 12 genotipos de tomate conservados en el banco de germoplasma del Instituto Nacional de Ciencias Agrícolas (INCA), Cuba, para detectar la presencia de los genes de resistencia a TYLCV (Ty.1, Ty.3) y a TSWV (SW5).

La extracción de ADN se realizó según el protocolo propuesto por Permingeat (1212. Permingeat HR, Romagnoli MV, Vallejos RH. A simple method for isolating high yield and quality DNA from cotton (Gossypium hirsutum L.) leaves. Plant Mol Biol. 1998; 16: 1-6. https://doi.org/10.1023/A:1007466522028). Se colectaron hojas asintomáticas de cada uno de los genotipos y fueron analizadas dos réplicas por cada genotipo.

La identificación de cada uno de los genes de resistencia se realizó mediante PCR (del inglés Polymerase Chain Reaction) en el termociclador TOUCH T960. Para ello se utilizaron cebadores específicos para los genes Ty.1, Ty.3 y SW5. (Tabla 1)

Las reacciones de amplificación se ajustaron a un volumen final de 25 ul. Se utilizó GoTaq Green Master Mix (Promega, Madison, WI, USA) con una concentración final de 1.5 mM MgCl2, 100 μM para cada uno de los dNTPs y cebadores utilizados y 15 ng de la muestra.

El programa de amplificación para detectar el gen Ty.3 consistió en un paso inicial de desnaturalización a 940C durante tres minutos, seguido por 35 ciclos de reacción (30 s a 940C de desnaturalización, 1 min a 530C de anillamiento de los cebadores y 1 min a 720C de extensión), seguido por un paso de extensión final durante 10 min a 720C. Un programa similar se utilizó para el gen Ty.1 teniendo en cuenta que la desnaturalización inicial fue de cinco minutos, seguido de 30 ciclos de reacción (30 s a 940C de desnaturalización, 1 min a 550C de anillamiento de los cebadores y 1 min a 720C de extensión) y un paso de extensión final de 10 min a 720C.

 
Tabla 1.  Cebadores utilizados para detectar los alelos (o locus) correspondientes a la presencia de los genes Ty.1, Ty.3 y SW5, relacionados con la resistencia a begomovirus y orthotospovirus. / Primers used to detect the alleles (or locus) corresponding to the presence of the genes Ty.1, Ty.3 and SW5, related to resistance to begomovirus and orthotospovirus.
GenCebador y secuenciaReferencia
Ty.1

  • UWTy1F 5´ ATA AGC ATT TCA TGT CAG ATG TCT AGA C 3´

  • UWTy1R 5´ CTA GAT CCT GGA TGA CTT CAA TAG C 3´

1313. García BE, Graham E, Jensen KS, Hanson P, Mejía L, Maxwell DP. Codominant SCAR marker for detection of the begomovirus-resistance Ty-2 locus derived from Solanum habrochaites in tomato germplasm. Tomato Genetic Cooperative Report. 2007; 57: 21-24.
Ty.3

  • FLUW-25F 5´ CAAGTGTGCATATACTTCATATTCACC 3´

  • FLUW-25R 5´ CCATATATAACCTCTGTTTCTATTTCGAC 3´

1414. Salus MS, Martin CT, Maxwell DP. PCR protocol for detection of introgression at 25 cM (Ty.3 locus). UW. Madison Team. 2006: 1-3.
SW5

  • Sw421F 5´GAC TTG TTG CCA TAG GTT CC 3´

  • Sw421R 5´ GCC CAC CCC GAA GTT AAT CC 3´

1515. Rodrigues Do Nascimento I, Maluf W, Figueira A, Menezes C, Vilela de Resende J, Faria M, et al. Marker assisted identification of tospovirus resistant tomato genotypes in segregating progenies. Scientia Agricola (Piracicaba, Braz.). 2009; 3(66):298-303.
 

El programa de PCR para la amplificación del gen SW5 consistió en una desnaturalización inicial a 940C por un minuto, seguido de 34 ciclos de reacción (30 s a 940C de desnaturalización, 30 s a 560C de anillamiento de los cebadores y 1 min a 720C de extensión), seguido por un paso de extensión final durante 10 min a 720C.

Los productos de amplificación se analizaron en geles de agarosa a 1 %, en tampón TE 0.5X pH 8,0 (10 mM Tris-HCl, 1 mM EDTA), corridos durante 30 minutos a 110 volt y teñidos con Bromuro de Etidio (0,5 ug/ml) (equipo DOC-PRINT VX5). En todos los casos se utilizó un marcador de peso molecular de 1 Kb (Promega, Madison, EE.UU.).

RESULTADOS Y DISCUSIÓN

Al analizar la presencia del gen Ty.3, de los 12 cultivares analizados, solo tres genotipos (201, 205 y 210) mostraron el alelo correspondiente a dicho gen que confiere resistencia a TYLCV-IL (Tabla 2); mientras que, el resto de los cultivares presentaron el patrón susceptible. La banda que se relacionó con el patrón resistente presentó un tamaño de 640 pb. El resultado coincidió con los obtenidos por Salus et al. (1414. Salus MS, Martin CT, Maxwell DP. PCR protocol for detection of introgression at 25 cM (Ty.3 locus). UW. Madison Team. 2006: 1-3.), al comprobar la presencia del locus Ty.3 en líneas e híbridos de tomate obtenidos por el programa de mejoramiento a Begomovirus en Guatemala.

El locus correspondiente al gen Ty.1 se detectó en los genotipos 201, 203 y 205 (Tabla 2), mediante la amplificación específica de un fragmento de 750 pb. Estos resultados coinciden con Aragon et al. (33. Aragón OE, Rojas A, Laguna T. Identificación de cultivares de tomate con resistencia a begomovirus utilizando marcadores moleculares tipo SCAR y CAPS. Biotecnología Vegetal. 2012; 12(2): 67-76.), que comprobó que al utilizar el marcador TG231, el gen Ty.1 presenta un alelo homocigoto de 750 pb que confiere resistencia a Begomovirus. Además, en estudios previos se ha determinado que el gen Ty.1 presenta un efecto de dominancia incompleta y que la mayoría de los cultivares comerciales de tomate con resistencia a TYLCV, poseen dicho gen (33. Aragón OE, Rojas A, Laguna T. Identificación de cultivares de tomate con resistencia a begomovirus utilizando marcadores moleculares tipo SCAR y CAPS. Biotecnología Vegetal. 2012; 12(2): 67-76.)

La detección del gen Ty.3 en tres de los genotipos estudiados sugiere la posibilidad de la utilización de los mismos para el avance de los programas de mejoramiento genético del tomate. Además, al menos en dos genotipos (201 y 205) existe la combinación de los de los genes Ty.1 y Ty.3. Este resultado sugiere la presencia de genotipos con genes pirimidizados para la resistencia a TYLCV-IL, lo cual se ha demostrado que constituye una estrategia útil para el incremento de la resistencia a TYLCV-IL (1616. Álvarez M, Dueñas F, Fuentes A, Martínez Y, Fernández R. Resistencia al Tomato Yellow Leaj Curl Virus (TYLCV-IL) en poblaciones F2 de tomate (S. lycopersicum L.), segregantes para los genes Ty.1 y Ty.2. Cultivos Tropicales. 2012; 33(4): 64-70.,1111. Gómez O, Piñón M, Martínez Y. Pyramiding TYLCV and TSWV resistance genes in tomato genotypes. Rev. Protección Veg. 2015; 30(2): 161-164.).

 
Tabla 2.  Detección de alelos para los genes de resistencia Ty.1 y Ty.3 en 12 genotipos de tomate mantenidos en la colección del Instituto Nacional de Ciencias Agrícolas (INCA), Cuba / Allele detection for Ty.1 and Ty.3 resistance genes in 12 tomato genotypes kept in the collection of the National Institute of Agricultural Sciences (INCA), Cuba.
MuestrasGen Ty.1Gen Ty.3
201++
202--
203+-
204--
205++
206--
207--
208--
209--
210-+
211--
212--
 

La amplificación de un fragmento (o locus) de 940 pb evidenció la presencia del gen SW5 que confiere resistencia al Orthotospovirus TSWV, en los genotipos 205 y 207 (Fig. 1). Estos resultados coinciden con los tamaños de banda obtenidos por Gabriel et al. (1717. Gabriel J, Sanabria D, Veramendi S, Plata G, Angulo A, Crespo M. Resistencia genética de híbridos de tomate [Solanum lycopersicum L. (Mill.)] al virus del bronceado (TSWV). Agronomía Costarricense. 2013; 37(1): 61-69. ISSN:0377-9424) al estudiar la resistencia de híbridos de tomate a los virus GRSV, TSWV y TCSV en Bolivia, mediante la detección de la presencia de alelos del gen SW5.

Debido a la gran variabilidad de especies virales existentes, a nivel internacional, numerosos son los trabajos en los que se reconoce la incorporación de varios genes/alelos como una estrategia apropiada en la búsqueda de una resistencia estable y amplia a estas enfermedades. Hoy en día, la piramidación de genes de resistencia en una línea o cultivar ha devenido como una estrategia potente que permite incrementar la durabilidad y estabilidad de la resistencia, además de que ha propiciado un avance considerable en las etapas del programa de mejoramiento genético de tomate (1818. Rodríguez A, Florido M, Dueñas F, Muñoz LJ, Hanson P, Álvarez M. Caracterización morfoagronómica en líneas de tomate (Solanum lycopersicum L.) con resistencia a Begomovirus. Cultivos Tropicales. 2017; 38(2):70-79.).

 
Figura 1.  Patrón electroforético de las amplificaciones del gen SW5 (cebadores Sw421F/R), donde: carril 1 PPM, patrón de peso molecular de 1kb; carril 2 al 13 cultivares 201-212./ Electrophoretic pattern of SW5 gene amplifications (primers Sw421F/R): lane 1 PPM, 1 kb molecular weight marker; lanes 2 to13, cultivars 201-212.
 

Estos resultados permiten sugerir el uso de los genotipos 205 y 201 para obtener cultivares con genes pirimidizados para la resistencia a TYLCV-IL. Particularmente importante es la presencia en el genotipo 205 de los tres genes estudiados, lo que lo señala como un genotipo promisorio con genes pirimidizados para la resistencia a las principales enfermedades virales que afectan el cultivo del tomate en Cuba. Además, se confirmó la importancia del uso de marcadores moleculares para lograr el avance en la obtención de variedades con resistencia a las enfermedades de mayor impacto en la producción.

 
 
 

 

REFERENCIAS
1. Sanches J. Generación de línea T-DNA de tomate (Solanum lycopersicum) para la identificación de mutantes de inserción alterados en la morfogénesis y el desarrollo vegetal. [Tesis de doctorado]. Universidad Politécnica de Valencia, Valencia, España. 2017.
2. Peter J, Stuart G, Elliot J, Arcady R, Evelien M, Donald M, et al. Changes to virus taxonomy and the Statutes ratified bythe International Committee on Taxonomy of Viruses. Archives of Virology. 2020. https://doi.org/10.1007/s00705-020-04752-x
3. Aragón OE, Rojas A, Laguna T. Identificación de cultivares de tomate con resistencia a begomovirus utilizando marcadores moleculares tipo SCAR y CAPS. Biotecnología Vegetal. 2012; 12(2): 67-76.
4. Ferrand L. Caracterización de aislamientos argentinos de Tomato spotted wilt virus que quiebran la resistencia mediada por el gen Tsw en Capsicum annuum L. [Tesis de doctorado]. Universidad Nacional de la Plata, La Plata, Argentina. 2017.
5. Martínez Y, Martínez MA, Quiñones M, Miranda I, Holt J, Chancellor T. Estudio de factores que influyen en la epifitología del complejo mosca blanca-geminivirus, en la región oriental de Cuba. Rev. Protección Veg. 2009; 24(1): 47-50.
6. Martínez-Zubiaur Y, Chang Sidorchuk L, González Álvarez H, Barboza Vargas N, González Arias G. First molecular evidence of Tomato chlorotic spot virus infecting Tomatoes in Cuba. Plant Disease. 2016; 100(9):1956.
7. Gómez O, Piñón M, Martínez Y, Quiñones, Fonseca D, Laterrot H. Breeding for resistance to begomovirus in tropic-adapted tomato genotypes. Plant Breeding. 2004; 123: 275-279.
8. Piñón M, Gómez O, Cornide MT. RFLP analysis of Cuban tomato breeding lines with resistance to Tomato yellow leaf curl virus. Acta Hort. 2005; 695:273-276.
9. Dueñas F, Álvarez M , Molina L, Arias Y. Identificación de los genes Ty-2 y Ty-3 de resistencia a Begomovirus y su grado de homocigosis en nuevas accesiones de tomate. Cultivos Tropicales. 2009; 30(1): 61-64.
10. Dueñas F, Álvarez M, Moya C, Martínez Y. Identificación del gen Ty-3, de resistencia a Begomovirus, en accesiones de Solanum lycopersicum L. Cultivos Tropicales. 2011; 32(3): 42-45.
11. Gómez O, Piñón M, Martínez Y. Pyramiding TYLCV and TSWV resistance genes in tomato genotypes. Rev. Protección Veg. 2015; 30(2): 161-164.
12. Permingeat HR, Romagnoli MV, Vallejos RH. A simple method for isolating high yield and quality DNA from cotton (Gossypium hirsutum L.) leaves. Plant Mol Biol. 1998; 16: 1-6. https://doi.org/10.1023/A:1007466522028
13. García BE, Graham E, Jensen KS, Hanson P, Mejía L, Maxwell DP. Codominant SCAR marker for detection of the begomovirus-resistance Ty-2 locus derived from Solanum habrochaites in tomato germplasm. Tomato Genetic Cooperative Report. 2007; 57: 21-24.
14. Salus MS, Martin CT, Maxwell DP. PCR protocol for detection of introgression at 25 cM (Ty.3 locus). UW. Madison Team. 2006: 1-3.
15. Rodrigues Do Nascimento I, Maluf W, Figueira A, Menezes C, Vilela de Resende J, Faria M, et al. Marker assisted identification of tospovirus resistant tomato genotypes in segregating progenies. Scientia Agricola (Piracicaba, Braz.). 2009; 3(66):298-303.
16. Álvarez M, Dueñas F, Fuentes A, Martínez Y, Fernández R. Resistencia al Tomato Yellow Leaj Curl Virus (TYLCV-IL) en poblaciones F2 de tomate (S. lycopersicum L.), segregantes para los genes Ty.1 y Ty.2. Cultivos Tropicales. 2012; 33(4): 64-70.
17. Gabriel J, Sanabria D, Veramendi S, Plata G, Angulo A, Crespo M. Resistencia genética de híbridos de tomate [Solanum lycopersicum L. (Mill.)] al virus del bronceado (TSWV). Agronomía Costarricense. 2013; 37(1): 61-69. ISSN:0377-9424
18. Rodríguez A, Florido M, Dueñas F, Muñoz LJ, Hanson P, Álvarez M. Caracterización morfoagronómica en líneas de tomate (Solanum lycopersicum L.) con resistencia a Begomovirus. Cultivos Tropicales. 2017; 38(2):70-79.
 
 

Recibido: 19/06/2020

Aceptado: 11/07/2020

 
 

Declaración de conflicto de intereses: Los autores declaran que no existe conflicto de intereses

Contribución de los autores: Heidy González Alvarez: Participó en la búsqueda de información, estandarización y pruebas realizadas para evaluar los resultados (amplificaciones de los ADN por PCR). Realizó en el análisis e interpretación de los resultados, así como la redacción del artículo. Yaniel Castro Reyes: Realizó la selección de los cultivares. Participó en las pruebas para evaluar los resultados y en la recolección de datos. Lidia Chang Sidorchuk: Participó en la búsqueda de información, en las pruebas para evaluar los resultados y en el análisis de los mismos. Yamila Martínez Zubiaur: Realizó el diseño de la investigación. Participó en la búsqueda de información, en el análisis e interpretación de los resultados, en la revisión crítica del documento y en la aprobación final.

 

Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons


 

Enlaces refback

  • No hay ningún enlace refback.