Artículo Reseña
 
Situación de vectores de CaLsol que infectan solanáceas en la región de las Américas. Implicaciones para Cuba. I: Elementos de su identificación, distribución y bioecología
Status of CaLsol vectors that infect solanaceous plants in the American regions, implications for Cuba. I: Elements of their identification, distribution, and bioecology
 

iDHeyker L. Baños Díaz1Laboratorio de Entomología-Acarología, Grupo Plagas Agrícolas, Dirección de Sanidad Vegetal, Centro Nacional de Sanidad Agropecuaria (CENSA), Apartado 10, San José de las Lajas, La Habana, Cuba. *✉:hlellani@censa.edu.cu

iDLizandra Guerra Arzuaga1Laboratorio de Entomología-Acarología, Grupo Plagas Agrícolas, Dirección de Sanidad Vegetal, Centro Nacional de Sanidad Agropecuaria (CENSA), Apartado 10, San José de las Lajas, La Habana, Cuba.

iDAlberto Fereres2Grupo Insectos Vectores de Patógenos de Plantas. Departamento de Protección de Plantas. Instituto de Ciencias Agrarias (ICA). Consejo Superior de Investigaciones Científicas (CSIC). Madrid. España

 

1Laboratorio de Entomología-Acarología, Grupo Plagas Agrícolas, Dirección de Sanidad Vegetal, Centro Nacional de Sanidad Agropecuaria (CENSA), Apartado 10, San José de las Lajas, La Habana, Cuba.

2Grupo Insectos Vectores de Patógenos de Plantas. Departamento de Protección de Plantas. Instituto de Ciencias Agrarias (ICA). Consejo Superior de Investigaciones Científicas (CSIC). Madrid. España

 

*Autor para la correspondencia: Heyker L. Baños Díaz. Email: hlellani@censa.edu.cu

 

RESUMEN

La seguridad alimentaria mundial estará amenazada en los próximos años por la aparición y propagación de plagas emergentes en los cultivos. Los psílidos se consideran posibles plagas destructivas, debido a la relación existente entre estos insectos y algunos importantes patógenos de plantas. Bactericera cockerelli Sulc (Hemiptera: Triozidae) es reconocido como vector eficiente de la bacteria Candidatus Liberibacter solanacearum (CaLsol), una plaga invasiva según la EPPO, causante de enfermedades en papa, tomate, pimiento, otras solanáceas, y algunas especies de Apiaceae. Se revisaron 61 artículos científicos relacionados con el tema, conociendo que el complejo vector-bacteria está presente en diferentes países del mundo en el continente americano, Europa y Nueva Zelanda. El cambio en las variables climáticas, la distribución biológica de este sistema insecto-vector, la alta plasticidad ecológica, que le permite desarrollar diferentes biotipos dependiendo de las características del área donde se desarrolle, pudieran complejizar el control/manejo del sistema insecto-patógeno. Estas características hacen necesario mantener una vigilancia extrema en aquellos países donde aún no se encuentra presente. Hasta el momento, la bacteria y el vector no se encuentran presentes en Cuba; sin embargo, la cercanía a países en las que está presente, la existencia de condiciones climáticas óptimas, de plantas hospedantes, así como el incremento del turismo y el comercio internacional, hacen necesario brindar información actualizada sobre esta enfermedad, los agentes causales y sus vectores, como una contribución a la preparación del personal científico-técnico-productivo y decisores.

Palabras clave: 
Bactericera cockerelli; cambio climático; Candidatus Liberibacter solanacearum (CaLso); plagas invasoras; vigilancia.
 
ABSTRACT

Global food security could be threatened in the coming years by the emergence and spread of emerging pests in crops. Psyllids are considered as possible destructive pests due to their relationships with some important plant pathogens. Bactericera cockerelli Sulc (Hemiptera: Triozidae) is recognized as an efficient vector of the bacterium Candidatus Liberibacter solanacearum (CaLsol), an invasive pest according to the EPPO, which causes diseases in potatoes, tomatoes, peppers, and other solanaceous and some apiaceous crops. Known the vector-bacteria complex to be present in different countries of the world belonging to the American continent, Europe and New Zealand, 61 scientific papers related to this topic were reviewed. Changes in the climatic variables, the biological distribution of this insect-vector system, the high ecological plasticity that allows this insect to develop different biotypes, depending on the characteristics of the area where it develops, could complicate the control of the insect-pathogen system. These characteristics make necessary a maintained extreme surveillance in those countries where it is not yet present. So far, the bacterium and the vector are not present in Cuba; however, its proximity to countries where it is present, the existence of optimal climatic conditions host plants, and the increasing tourism and international trade, make necessary to offer updated information on this disease, the causal agents and their vectors as a contribution to the preparation of the scientific-technical-productive personnel and other decission makers.

Keywords: 
Bactericera cockerelli; Candidatus Liberibacter solanacearum (CaLso); climate change; invasive pests; surveillance.
 
 
 
INTRODUCCIÓN

La producción de alimentos es uno de los principales desafíos que enfrenta la humanidad en la actualidad. Se espera que la población mundial aumente en 2 000 millones de personas en los próximos 30 años, de 7700 millones en la actualidad a 9 700 millones en 2050; casi todo este crecimiento tendrá lugar en los países en desarrollo (11. ONU. Creciendo a un ritmo menor, se espera que la población mundial alcanzará 9.700 millones en 2050 y un máximo de casi 11.000 millones alrededor de 2100: Informe de la ONU. Perspect la Población Mund 2019 [Internet]. 2019;1:1-4. Available from: https://population.un.org/wpp/Publications/Files/WPP2019_PressRelease_ES.pdf ). Las proyecciones estadísticas muestran que, para alimentar la población mundial en 2050, sería necesario aumentar la producción de alimentos en más de 70 %.

Un estudio realizado por diversos autores proyectó que la seguridad alimentaria mundial se verá amenazada, en los próximos años, por la aparición y propagación de plagas emergentes en los cultivos de mayor interés (22. Karuppaiah V, Sujayanad GK. Impact of climate change on population dynamics of insect pests. World J Agric Sci [Internet]. 2012;8(3):240-6. Available from: https://www.researchgate.net/publication/259240426 , 33. Bebber DP, Ramotowski MAT, Gurr SJ. Crop pests and pathogens move polewards in a warming world. Nat Clim Chang [Internet]. 2013;3(11):985-8. Available from: http://dx.doi.org/10.1038/nclimate1990 ). Este escenario será favorecido, principalmente, por el comercio y el transporte intercontinental. Sin embargo, el cambio climático tiene una función importante en el establecimiento de estas plagas en regiones, hasta ahora inadecuadas para ellas, en especial para algunos órdenes de insectos, entre ellos Hemiptera.

Las plantas de la familia Solanaceae están ampliamente distribuidas en el mundo. Especies cultivadas y silvestres habitan prácticamente en cualquier región o país, aunque se encuentran, mayormente, en América del Sur. Históricamente, las especies Solanum lycopersicum L. (tomate), Solanum melongena L. (berenjena), Solanum tuberosum (papa), Nicotiana tabacum (tabaco) y Capsicum spp. (ajíes), son de mayor relevancia, por constituir fuentes de alimentos e ingresos para diversos países, tanto de las Américas como de Europa. Numerosas plagas (invertebrados y patógenos) están restringidas solamente a plantas pertenecientes a esta familia, por ejemplo, el escarabajo de la papa (Leptinotarsa decemlineata Say) y hongos como Phytophthora infestans (Mont.) de Bary, donde es común el intercambio de hospedantes entre cultivos y especies silvestres (44. Syfert MM, Serbina L, Burckhardt D, Knapp S, Percy DM. Emerging new crop pests: Ecological modelling and analysis of the South American potato psyllid Russelliana solanicola (Hemiptera: Psylloidea) and its wild relatives. PLoS One. 2017;12(1).).

Los psílidos (Hemiptera: Psylloidea) comprenden especies que son plagas importantes de una gran variedad de plantas de cultivo (55. Munyaneza JE, Henne DC. Leafhopper and Psyllid Pests of Potato [Internet]. Insect Pests of Potato. Elsevier Inc.; 2013. 65-102 p. Available from: http://dx.doi.org/10.1016/B978-0-12-386895-4.00004-1 ). En las últimos años, merecieron especial interés especies como Bactericera cockerelli (Sulc) (Hemiptera: Triozidae) (psílido de la papa / tomate), reconocido en Estados Unidos de América (EUA) como una plaga importante de los cultivos de solanáceas durante décadas y considerada como una potencial plaga destructiva desde su descripción en 1909 (66. Butler CD, Trumble JT. The potato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Triozidae): life history, relationship to plant diseases, and management strategies. Terr Arthropod Rev [Internet]. 2012;5(2):87-111. Available from: http://booksandjournals.brillonline.com/content/journals/10.1163/187498312x634266 ). Actualmente, se conoce que este insecto es vector de la bacteria Candidatus Liberibacter solanacearum (Ca. L. psyllaurous) (CaLsol), causante de la enfermedad de 'chip de cebra' (ZC) (77. Liu D, Trumble JT. Comparative fitness of invasive and native populations of the potato psyllid (Bactericera cockerelli). Entomol Exp Appl [Internet]. 2007 Apr;123(1):35-42. Available from: http://onlinelibrary.wiley.com/doi/10.1111/j.1570-7458.2007.00521.x/full , 88. Butler CD, Walker GP, Trumble JT. Feeding disruption of potato psyllid, Bactericera cockerelli, By imidacloprid as measured by electrical penetration graphs. Entomol Exp Appl. 2012;142(3):247-57.).

Epidemias que involucran diferentes especies de plantas, psílidos y Ca. Liberibacter se presentaron en diferentes países de varios continentes. La incidencia y severidad de la enfermedad varía de un año a otro y es afectada por múltiples factores, incluidos el tamaño de la población de vectores de psílidos y sus depredadores, las condiciones climáticas, cambios en la variedad de plantas de cultivo y las prácticas agrícolas (99. Haapalainen M. Biology and epidemics of Candidatus Liberibacter species, psyllid-transmitted plant-pathogenic bacteria. Ann Appl Biol [Internet]. 2014 Sep [cited 2019 Jan 8];165(2):172-98. Available from: http://doi.wiley.com/10.1111/aab.12149 ).

En la actualidad, el sistema psílidos-Ca Liberibacter solanacearum causa pérdidas económicas sustanciales en un amplio rango geográfico. Su presencia en numerosos países de la región de las Américas hace necesario que se desarrollen medidas de prevención y planes de manejo, antes de que se establezcan poblaciones de este insecto. La información prediagnóstica y la capacitación a técnicos, especialistas, productores y administrativos son las herramientas idóneas para obtener información en tiempo real, que apoyan la vigilancia de esta bacteria y su vector, con el objetivo de mejorar la oportunidad y la eficiencia en los sistemas de detección. El objetivo del presente trabajo consistió en brindar una información actualizada sobre los psílidos vectores de la bacteria Ca. Liberibacter solanacearum en cultivos de solanáceas, sus características biológicas, dispersión y establecimiento en nuevas áreas, como una contribución a la preparación del personal científico-técnico-productivo y decisores.

PARTE ESPECIAL
Distribución geográfica

De acuerdo con Burckhardt (1010. Burckhardt DH. Psylloid pest of temperate and subtropical crop and ornamental plants (Hemiptera, Psylloidea):A review. Trends Agril Sci. 1994;2:173-86.), los psiloides tienen una distribución mundial, pero son más diversos en áreas tropicales y subtropicales. Actualmente B. cockerelli causa pérdidas económicas sustanciales en una amplia zona geográfica. Aunque es endémica de América del Norte, se encuentra en Canadá, México, América Central (66. Butler CD, Trumble JT. The potato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Triozidae): life history, relationship to plant diseases, and management strategies. Terr Arthropod Rev [Internet]. 2012;5(2):87-111. Available from: http://booksandjournals.brillonline.com/content/journals/10.1163/187498312x634266 , 1111. Castillo C, Fu Z, Burckhardt D. First record of the tomato potato Psyllid Bactericera Cockerelli from South America. Bull Insectology. 2019;72(1):85-91., 1212. Munyaneza JE, Crosslin JM, Upton JE. Association of Bactericera cockerelli (Homoptera: Psyllidae) with “Zebra Chip,” a New Potato Disease in Southwestern United States and Mexico. J Econ Entomol [Internet]. 2007;100(3):656-63. Available from: http://openurl.ingenta.com/content/xref?genre=article&issn=0022-0493&volume=100&issue=3&spage=656 ) y Nueva Zelanda (1313. Crosslin JM, Munyaneza JE, Brown JK, Liefting LW. Potato Zebra Chip Disease: A Phytopathological Tale. Plant Heal Prog [Internet]. 2010 Jan [cited 2019 Jan 8];11(1):33. Available from: https://apsjournals.apsnet.org/doi/10.1094/PHP-2010-0317-01-RV ).

B. cockerelli es el principal vector de CaLsol en la papa y otros cultivos de solanáceas en las Américas y Nueva Zelanda; sin embargo, está ausente en Europa. No obstante, otras especies de este mismo género, que se encuentran distribuidas en diversos países de Europa, son Bactericera maculipennis (Crawford) (1414. Borges KM, Cooper WR, Garczynski SF, Thinakaran J, Jensen AS, Horton DR, et al. “Candidatus Liberibacter solanacearum” associated with the psyllid, Bactericera maculipennis (Hemiptera: Triozidae). Environ Entomol. 2017;46(2):210-6.), Bactericera nigricornis (Foerster), Bactericera tremblayi (Wagner) y Bactericera trigonica Hodkinson, esta última es la especie más importante en el sur de Europa (1515. Castillo CI, Jensen AS, Snyder WE. Checklist of the Psylloidea (Hemiptera) of the U . S . Pacific Northwest. PROC ENTOMOL SOC WASH. 2016;118(4):498-509.). Otras especies de psílidos se encuentran presentes en Finlandia (Trioza apicalis Foerster) (1616. Munyaneza JE, Fisher TW, Sengoda VG, Garczynski SF, Nissinen A, Lemmetty A. Association of “Candidatus Liberibacter solanacearum” With the Psyllid, Trioza apicali (Hemiptera: Triozidae) in Europe. J Econ Entomol [Internet]. 2010;103(4):1060-70. Available from: https://academic.oup.com/jee/article-lookup/doi/10.1603/EC10027 ), Brasil (Russelliana solanicola Tutill) (1717. Munyaneza JE, Henne DC. Leafhopper and Psyllid Pests of Potato [Internet]. Insect Pests of Potato. Elsevier Inc.; 2013 [cited 2019 Jan 8]. 65-102 p. Available from: https://linkinghub.elsevier.com/retrieve/pii/B9780123868954000041 ) y Australia (Acizzia solanicola (Kent y Taylor)) que fue identificada como una plaga potencialmente importante de la berenjena (1818. Morris J, Shiller J, Mann R, Smith G, Yen A, Rodoni B. Novel ‘Candidatus Liberibacter’ species identified in the Australian eggplant psyllid, Acizzia solanicola. Microb Biotechnol [Internet]. 2017 Jul [cited 2019 Jan 8];10(4):833-44. Available from: http://doi.wiley.com/10.1111/1751-7915.12707 ). Todas estas especies tienen en común la presencia de bacterias endosimbiontes, capaces de causar enfermedades letales en plantas de interés económico. (Tabla 1)

Aunque B. cockerelli se encuentra ampliamente distribuida, fundamentalmente en América de Norte y América Central, podría constituir amenaza potencial para los países que, ubicados en esas regiones, no informaron aún la presencia de estos insectos, debido a su adaptabilidad y amplia gama de hospedantes. Otra especie que constituye una amenaza es R. solanicola,

R. solanicola se encontró en plantas de Datura sp. en Perú y es el primer psílido que se informó como un posible vector de virus de plantas (1919. Salazar LF. Emerging and re-emerging potato diseases in the Andes. Potato Res. 2006;49(1):43-7.), aspecto que necesita mayor estudio. Kuhn et al. (2020. Kuhn; TM de A, Burckhardt D, Queiroz DL de, Teresani GR, Lopes JRS. Occurrence of Russelliana solanicola Tuthill, 1959 (Hemiptera: Psyllidae), potencial vector of "Candidatus Liberibacter solanacearum" on carrot crops. 2016;1959:2016.) plantearon que R. solanicola puede ser considerado como un vector potencial de la bacteria Candidatus Liberibacter solanacearum. Se informó como plaga en los cultivos de papa en Perú y Chile (55. Munyaneza JE, Henne DC. Leafhopper and Psyllid Pests of Potato [Internet]. Insect Pests of Potato. Elsevier Inc.; 2013. 65-102 p. Available from: http://dx.doi.org/10.1016/B978-0-12-386895-4.00004-1 ) y se considera una amenaza emergente, potencialmente grave en América del Sur, para cultivos como papa (2020. Kuhn; TM de A, Burckhardt D, Queiroz DL de, Teresani GR, Lopes JRS. Occurrence of Russelliana solanicola Tuthill, 1959 (Hemiptera: Psyllidae), potencial vector of "Candidatus Liberibacter solanacearum" on carrot crops. 2016;1959:2016.), tomate y pimiento (44. Syfert MM, Serbina L, Burckhardt D, Knapp S, Percy DM. Emerging new crop pests: Ecological modelling and analysis of the South American potato psyllid Russelliana solanicola (Hemiptera: Psylloidea) and its wild relatives. PLoS One. 2017;12(1).). R. solanicola y A. solanicola se consideraron plagas emergentes y, potencialmente globales, en el caso de R. solanicola, cuyo manejo es menos complejo con la identificación temprana de las áreas que probablemente serán invadidas (55. Munyaneza JE, Henne DC. Leafhopper and Psyllid Pests of Potato [Internet]. Insect Pests of Potato. Elsevier Inc.; 2013. 65-102 p. Available from: http://dx.doi.org/10.1016/B978-0-12-386895-4.00004-1 , 2222. Brlansky RH, Chung KR, Rogers ME. 2006 Florida Citrus Pest Management Guide : Huanglongbing ( Citrus Greening ) 1. 2006;1-3.).

 
Tabla 1.  Especies de psílidos y microorganismos endosimbiontes asociados causantes de enfermedades en plantas de interés económico. / Psyllid species and associated endosymbiotic microorganisms causing diseases in plants of economic interest.
EspeciesFamiliaMicrorganismoDistribuciónReferencias
B. trigonica HodkinsonTriozidaeCandidatus Liberibacter solanacearum Candidatus Phytoplasma spp. Europa 1212. Munyaneza JE, Crosslin JM, Upton JE. Association of Bactericera cockerelli (Homoptera: Psyllidae) with “Zebra Chip,” a New Potato Disease in Southwestern United States and Mexico. J Econ Entomol [Internet]. 2007;100(3):656-63. Available from: http://openurl.ingenta.com/content/xref?genre=article&issn=0022-0493&volume=100&issue=3&spage=656 ,1515. Castillo CI, Jensen AS, Snyder WE. Checklist of the Psylloidea (Hemiptera) of the U . S . Pacific Northwest. PROC ENTOMOL SOC WASH. 2016;118(4):498-509.
B. tremblayi (Wagner)
B. nigricornis (Foerster)
Dyspersa (=Trioza) apicalis (Foerster) Candidatus Liberibacter solanacearumAmérica del Norte, Canadá, México, América Central 66. Butler CD, Trumble JT. The potato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Triozidae): life history, relationship to plant diseases, and management strategies. Terr Arthropod Rev [Internet]. 2012;5(2):87-111. Available from: http://booksandjournals.brillonline.com/content/journals/10.1163/187498312x634266 , 77. Liu D, Trumble JT. Comparative fitness of invasive and native populations of the potato psyllid (Bactericera cockerelli). Entomol Exp Appl [Internet]. 2007 Apr;123(1):35-42. Available from: http://onlinelibrary.wiley.com/doi/10.1111/j.1570-7458.2007.00521.x/full ,1212. Munyaneza JE, Crosslin JM, Upton JE. Association of Bactericera cockerelli (Homoptera: Psyllidae) with “Zebra Chip,” a New Potato Disease in Southwestern United States and Mexico. J Econ Entomol [Internet]. 2007;100(3):656-63. Available from: http://openurl.ingenta.com/content/xref?genre=article&issn=0022-0493&volume=100&issue=3&spage=656
B. cockerelli (Sulc)
B. maculipennis (Crawford) 1414. Borges KM, Cooper WR, Garczynski SF, Thinakaran J, Jensen AS, Horton DR, et al. “Candidatus Liberibacter solanacearum” associated with the psyllid, Bactericera maculipennis (Hemiptera: Triozidae). Environ Entomol. 2017;46(2):210-6.
Candidatus Liberibacter africanus África, España y Portugal 2323. Haapalainen M, Wang J, Latvala S, Lehtonen MT, Pirhonen M, Nissinen AI. Genetic Variation of ‘Candidatus Liberibacter solanacearum’ Haplotype C and Identification of a Novel Haplotype from Trioza urticae and Stinging Nettle. Phytopathology [Internet]. 2018 Aug [cited 2019 Jan 8];108(8):925-34. Available from: https://apsjournals.apsnet.org/doi/10.1094/PHYTO-12-17-0410-R
Trioza erytreae Del Guercio
Trioza urticae Linnaeus,Candidatus Liberibacter solanacearumEuropa 2424. Sumner-Kalkun JC, Lund MJS, Arnsdorf YM, Carnegie M, Highet F, Ouvrard D, et al. A diagnostic real-time PCR assay for the rapid identification of the tomato-potato psyllid, Bactericera cockerelli (S development of a psyllid barcoding database. PLoS One. 2020;15(3):1-18., 2525. Thompson S, Fletcher JD, Ziebell H, Beard S, Panda P, Jorgensen N, et al. First report of ’ Candidatus Liberibacter europaeus’ associated with psyllid infested Scotch broom. New Dis Reports [Internet]. 2013;27:6. Available from: http://www.ndrs.org.uk/article.php?id=027006
Trioza anthrisci BurckhardtCandidatus Liberibacter solanacearumEuropa 2424. Sumner-Kalkun JC, Lund MJS, Arnsdorf YM, Carnegie M, Highet F, Ouvrard D, et al. A diagnostic real-time PCR assay for the rapid identification of the tomato-potato psyllid, Bactericera cockerelli (S development of a psyllid barcoding database. PLoS One. 2020;15(3):1-18.,2525. Thompson S, Fletcher JD, Ziebell H, Beard S, Panda P, Jorgensen N, et al. First report of ’ Candidatus Liberibacter europaeus’ associated with psyllid infested Scotch broom. New Dis Reports [Internet]. 2013;27:6. Available from: http://www.ndrs.org.uk/article.php?id=027006
Cacopsylla pyri (L.) PsyllidaeCandidatus Liberibacter europaeusEuropa 2626. Raddadi N, Gonella E, Camerota C, Pizzinat A, Tedeschi R, Crotti E, et al. “Candidatus Liberibacter europaeus” sp. nov. that is associated with and transmitted by the psyllid Cacopsylla pyri apparently behaves as an endophyte rather than a pathogen. Environ Microbiol. 2011;13(2):414-26., 2727. Jarausch B, Jarausch W. Establishment of a permanent rearing of Cacopsylla picta (Hemiptera: Psylloidea), the main vector of “Candidatus Phytoplasma mali” in Germany. J Pest Sci (2004). 2014;87(3):459-67.
Cacopsylla picta FoersterCandidatus Phytoplasma maliEuropa, India, Rusia, Canadá 2828. Orlovskis Z, Canale MC, Thole V, Pecher P, Lopes JR, Hogenhout SA. ScienceDirect Insect-borne plant pathogenic bacteria : getting a ride goes beyond physical contact. Curr Opin Insect Sci. 2015;9:16-23.
Cacopsylla pruni (Scopoli)Candidatus Phytoplasma prunorumEuropa 2929. Fialová R, Navrátil M, Lauterer P, Navrkalová V. “Candidatus Phytoplasma prunorum”: The phytoplasma infection of cacopsylla pruni from apricot orchards and from overwintering habitats in Moravia (Czech Republic). Bull Insectology. 2007;60(2):183-4., 3030. Alemán J, Baños H, Ravelo J. Diaphorina citri y la enfermedad Huanglongbing: Una combinación destructiva para la producción citrícola. Rev Protección Veg. 2007;22(3):154-65.
R. solanicola TuthillCandidatus Liberibacter solanacearum Dos nuevos virus no caracterizados: (SB26/29 y SB41)América del Sur, Argentina, Chile, Perú, Uruguay, Brasil 55. Munyaneza JE, Henne DC. Leafhopper and Psyllid Pests of Potato [Internet]. Insect Pests of Potato. Elsevier Inc.; 2013. 65-102 p. Available from: http://dx.doi.org/10.1016/B978-0-12-386895-4.00004-1 , 2020. Kuhn; TM de A, Burckhardt D, Queiroz DL de, Teresani GR, Lopes JRS. Occurrence of Russelliana solanicola Tuthill, 1959 (Hemiptera: Psyllidae), potencial vector of "Candidatus Liberibacter solanacearum" on carrot crops. 2016;1959:2016., 2121. Syfert MM, Serbina L, Burckhardt D, Knapp S, Percy DM. Emerging new crop pests: Ecological modelling and analysis of the South American potato psyllid Russelliana solanicola (Hemiptera: Psylloidea) and its wild relatives. PLoS One [Internet]. 2017;12(1):1-18. Available from: http://dx.doi.org/10.1371/journal.pone.0167764 , 2222. Brlansky RH, Chung KR, Rogers ME. 2006 Florida Citrus Pest Management Guide : Huanglongbing ( Citrus Greening ) 1. 2006;1-3.
A. solanicola (Kent & Taylor). Candidatus Liberibacter brunswickensisAustralia 1818. Morris J, Shiller J, Mann R, Smith G, Yen A, Rodoni B. Novel ‘Candidatus Liberibacter’ species identified in the Australian eggplant psyllid, Acizzia solanicola. Microb Biotechnol [Internet]. 2017 Jul [cited 2019 Jan 8];10(4):833-44. Available from: http://doi.wiley.com/10.1111/1751-7915.12707 , 1919. Salazar LF. Emerging and re-emerging potato diseases in the Andes. Potato Res. 2006;49(1):43-7.
Arytainilla spartiophila FoersterCandidatus Liberibacter europaeusEuropa 2626. Raddadi N, Gonella E, Camerota C, Pizzinat A, Tedeschi R, Crotti E, et al. “Candidatus Liberibacter europaeus” sp. nov. that is associated with and transmitted by the psyllid Cacopsylla pyri apparently behaves as an endophyte rather than a pathogen. Environ Microbiol. 2011;13(2):414-26.
Diaphorina citri KuyawamaLiviidaeCandidatus Liberibacter asiaticus Candidatus Liberibacter americanusMedio Oriente, América del Sur y América Central, México, Caribe 3131. Ouvrard D, Chalise P, Percy DM. Host-plant leaps versus host-plant shuffle: A global survey reveals contrasting patterns in an oligophagous insect group (Hemiptera, Psylloidea). Syst Biodivers. 2015;13(5):434-54.
 

PRINCIPALES CARACTERÍSTICAS PARA SU IDENTIFICACIÓN

Dentro de los psílidos (Orden Hemiptera,Suborden Sternorryncha: Superfamilia Psylloidea), se agrupan especies que son plagas importantes de una gran variedad de plantas de cultivo. Hasta el momento, se describieron alrededor 3 800 especies (3131. Ouvrard D, Chalise P, Percy DM. Host-plant leaps versus host-plant shuffle: A global survey reveals contrasting patterns in an oligophagous insect group (Hemiptera, Psylloidea). Syst Biodivers. 2015;13(5):434-54.). Estos insectos suelen ser altamente específicos, con estados inmaduros que se desarrollan en una única planta hospedante o unas pocas especies vegetales estrechamente relacionadas. Los psílidos dañan a las plantas, tanto por sus efectos negativos sobre el crecimiento de estas cuando se alimentan, o por su potencial para actuar como vectores de una variedad de patógenos de plantas (3232. Prager SM, Trumble JT. Psyllids: Biology, Ecology, and Management [Internet]. Sustainable Management of Arthropod Pests of Tomato. Elsevier Inc.; 2018. 163-181 p. Available from: https://doi.org/10.1016/B978-0-12-802441-6.00007-3 ).

Taxonomía de B. cockerelli

Este insecto se describió en 1909, a partir de especímenes recolectados de Capsicum sp. en Colorado (Šulc), EUA, y se nombró como Trioza cockerelli Colorado (Šulc). Posteriormente, de conjunto con descripciones sobre su biología y morfología de los estados inmaduros, se ubicó en un nuevo género, Paratrioza. En 1997 (3333. Burckhardt D, Lauterer P. A taxonomic reassessment of the triozid genus Bactericera (Hemiptera: Psylloidea). J Nat Hist. 1997;31(1):99-153.) y luego en 2009 (3434. Hodkinson ID. Life cycle variation and adaptation in jumping plant lice ( Insecta : Hemiptera : Psylloidea ): a global synthesis. 2009;43(January):65-179.), tras un nuevo análisis de los géneros Bactericera y Triozidae, se ubica a este psílido en el género Bactericera y la familia Triozidae (3535. Ouvrard D. Psyl’list - The World Psylloidea Database. [Internet]. 2020. 2020 [cited 2020 Jun 24]. Available from: http://www.hemiptera-databases.com/psyllist ).

  • Nombre científico: Bactericera cockerelli (Šulc) 1909

  • Nombre común: psílido de la papa/ tomate

  • Sinonimias:

    • Paratrioza cockerelli (Šulc) 1909

    • Trioza cockerelli (Šulc) 1909

  • Nombres comunes internacionales

  • Inglés: potato psyllid, tomato psyllid;

  • Español: pulgón saltador de la papa (México); pulgón saltador del tomate (México)

  • Francés: psylle de la pomme de terre; psylle de la tomate

  • Código EPPO: PARZCO (Paratrioza cockerelli)

Características morfológicas de B. cockerelli (3636. University of Tasmania TI of A (TIA). Key to distinguish the tomato-potato psyllid from other psyllids. 2017.)

B. cockerelli es un insecto pequeño, de aproximadamente 2,5-2,75 mm de largo, parecen pequeñas cigarras, pues mantienen sus alas en ángulo y en forma de cubierta sobre el cuerpo. Son muy activos, capaces de saltar y volar grandes distancias y se pueden observar claramente con lupas entomológicas. Poseen dos pares de alas membranosas, con venas visibles, y considerablemente más grandes que las traseras. Muestran líneas prominentes, blancas o amarillas, en la cabeza y el tórax y se localizan bandas blanquecinas dorsales en los segmentos abdominales primero y terminal.

Estas marcas blancas son características en esta especie de psílido, particularmente la amplia banda blanca transversal en el primer segmento abdominal y la marca blanca en forma de 'V' invertida en el último segmento abdominal (3333. Burckhardt D, Lauterer P. A taxonomic reassessment of the triozid genus Bactericera (Hemiptera: Psylloidea). J Nat Hist. 1997;31(1):99-153., 3737. Wallis RL. Ecological studies on the Potato psyllid as pest of potatoes. USDA Tech Bull. 1955;(1107):1-24., 3838. Cerna-Chavez E, Hernández-Bautista O, Ochoa-Fuentes YM, Landeros-Flores J, Aguirre-Uribe LA, Hernández-Juárez A. Morfometría de inmaduros y tablas de vida de Bactericera cockerelli (Hemiptera: Triozidae) de poblaciones del noreste de México. Rev Colomb Entomol. 2018;44(1):53-60.), junto con una línea blanca elevada alrededor de la circunferencia de la cabeza (Figura 1). Los adultos son activos, en contraste con las etapas de las ninfas que son, en gran medida, sedentarias. Estos insectos son buenos voladores y saltan fácilmente cuando se les molesta.

 
*Imágenes cortesía del Dr Paul Walker, Instituto de Agricultura de Tasmania, Universidad de Tasmania/ Image courtesy of Dr Paul Walker from Tasmanian Institute of Agriculture, University of Tasmania. (3636. University of Tasmania TI of A (TIA). Key to distinguish the tomato-potato psyllid from other psyllids. 2017.)
Figura 1.  Principales caracteres para el reconocimiento de B. cockerelli. (A: Cabeza con conos genales cortos (cuando se ve desde arriba) y marcas blanquecinas claras en el vértice; B: Antenas con rinarium en forma de disco en el cuarto segmento; C: tiene un espolón apical externo y dos internos (1 + 2); D: forma de terminalia macho y hembra) (2626. Raddadi N, Gonella E, Camerota C, Pizzinat A, Tedeschi R, Crotti E, et al. “Candidatus Liberibacter europaeus” sp. nov. that is associated with and transmitted by the psyllid Cacopsylla pyri apparently behaves as an endophyte rather than a pathogen. Environ Microbiol. 2011;13(2):414-26.). / Main traits for the recognition of B. cockerelli. (A: Head with short genial cones (when viewed from above) and pale whitish markings on the vertex; B: Antennae with disc-shaped rhinarium on the fourth segment; C: it has an external apical spur and two internal (1 + 2); D: male and female terminalia shape) (2626. Raddadi N, Gonella E, Camerota C, Pizzinat A, Tedeschi R, Crotti E, et al. “Candidatus Liberibacter europaeus” sp. nov. that is associated with and transmitted by the psyllid Cacopsylla pyri apparently behaves as an endophyte rather than a pathogen. Environ Microbiol. 2011;13(2):414-26.)
 

 
*Imágenes cortesía del Dr Paul Walker, Instituto de Agricultura de Tasmania, Universidad de Tasmania/ Image courtesy of Dr Paul Walker from Tasmanian Institute of Agriculture, University of Tasmania.
Figura 2.  Diferencias morfológicas entre las alas de insectos pertenecientes a la familia Psilliodea (A: tiene tres ramas (trifurcado) ej: Triozida, en Bactericera cockerelli la membrana del ala delantera es completamente incolora y la celda cubital es corta y compacta; y B: otras familias de psílidos tiene dos ramas (bifurcado)) (2626. Raddadi N, Gonella E, Camerota C, Pizzinat A, Tedeschi R, Crotti E, et al. “Candidatus Liberibacter europaeus” sp. nov. that is associated with and transmitted by the psyllid Cacopsylla pyri apparently behaves as an endophyte rather than a pathogen. Environ Microbiol. 2011;13(2):414-26.). / Morphological differences between the wings of insects belonging to the Psilliodea family (A: it has three branches (trifurcated) ex: Triozida, in Bactericera cockerelli the membrane of the front wing is completely colorless and the ulnar cell is short and compact; and B: other families of psyllids has two branches (bifurcated))
 

Morfología de los estados inmaduros

Las hembras colocan los huevos de forma individual, soportados por un pedúnculo de aproximadamente 0,48-0,51 mm, miden entre 0,32-0,34 mm de largo, 0,13-0,15 mm de ancho y los colocan, frecuentemente, en el envés y cerca del margen de la hoja. Son inicialmente de color amarillo claro y se tornan más oscuros o naranja, según se va acercando el momento de eclosión (3232. Prager SM, Trumble JT. Psyllids: Biology, Ecology, and Management [Internet]. Sustainable Management of Arthropod Pests of Tomato. Elsevier Inc.; 2018. 163-181 p. Available from: https://doi.org/10.1016/B978-0-12-802441-6.00007-3 ).

Las ninfas son sedentarias, elípticas y aplanadas y pueden confundirse, en ocasiones, con ninfas de moscas blancas. Poseen cinco instares ninfales, cada uno con características morfológicas muy similares al anterior. Con cada instar aumentan el tamaño de las almohadillas alares en desarrollo y el ancho del cuerpo (0,23 hasta 1,60 mm) (3838. Cerna-Chavez E, Hernández-Bautista O, Ochoa-Fuentes YM, Landeros-Flores J, Aguirre-Uribe LA, Hernández-Juárez A. Morfometría de inmaduros y tablas de vida de Bactericera cockerelli (Hemiptera: Triozidae) de poblaciones del noreste de México. Rev Colomb Entomol. 2018;44(1):53-60., 3939. EPPO. PM 9/25 (1) Bactericera cockerelli and ‘Candidatus Liberibacter solanacearum.’ EPPO Bull [Internet]. 2017 Dec [cited 2019 Jan 8];47(3):513-23. Available from: http://doi.wiley.com/10.1111/epp.12442 ). En un inicio, las ninfas son de color naranja pero, a medida que maduran, cambian y se tornan de verde amarillento a verde. Presentan ojos compuestos, de color rojizo y bastante prominentes. En el tercer estadio, las almohadillas alares son evidentes, de color claro y se vuelven más pronunciadas con cada muda. Al igual que otras especies de psílidos, presentan una franja corta de filamentos de cera a lo largo de los márgenes laterales del cuerpo. Tanto las ninfas como los adultos, extraen elevadas cantidades de savia durante el proceso de alimentación, y producen grandes cantidades de miel de rocío que puede adherirse al follaje y las frutas, lo que propicia la formación de fumagina en la superficie de las hojas y provoca disminución de la fotosíntesis (3232. Prager SM, Trumble JT. Psyllids: Biology, Ecology, and Management [Internet]. Sustainable Management of Arthropod Pests of Tomato. Elsevier Inc.; 2018. 163-181 p. Available from: https://doi.org/10.1016/B978-0-12-802441-6.00007-3 ).

Identificación y taxonomía molecular

Es significativo el impacto en la agricultura de la presencia de B. cockerelli, o cualquier otro vector de la bacteria CaLso, por lo que su introducción natural o intencionada pudiera ser devastadora para la producción de solanáceas (papa, pimiento, tomate, tabaco, entre otras especies). Por esta razón, y teniendo en consideración también que en numerosas ocasiones existe escasez de especialistas con experiencia en este grupo taxonómico, se hace necesario el uso de herramientas moleculares para una identificación rápida y precisa.

Por este motivo, en el caso de algunas plagas de gran importancia económica a nivel internacional, como lo es este psílido, se hace necesario la aplicación de técnicas para el diagnóstico molecular, como complemento de las claves morfo-taxonómicas, que permitan la identificación rápida independientemente del estadio encontrado (huevos, ninfas y/o adultos). El uso de estas técnicas, como fortaleza en el monitoreo y prevención de la diseminación de B. cockerelli, podría ser una herramienta fundamental para prevenir el riesgo de posibles brotes de CaLso en solanáceas en áreas donde aún no se encontró el vector y la bacteria, y como apoyo a las estrategias de erradicación, manejo y/o control (3939. EPPO. PM 9/25 (1) Bactericera cockerelli and ‘Candidatus Liberibacter solanacearum.’ EPPO Bull [Internet]. 2017 Dec [cited 2019 Jan 8];47(3):513-23. Available from: http://doi.wiley.com/10.1111/epp.12442 ). Por ello, se desarrollaron técnicas de extracción de ADN no destructiva, secuenciación de ADN en la región COI (D. citri, Trioza remota Foerster , Trioza albiventris Foerster, T. anthriscii y Trioza apicalis Forster) e ITS2 (B. cockerelli, Bactericera albiventris Foerster, Bactericera curvatinervis Forster, Cacopsylla pulchra (Zetterstedt), Cacopsylla brunneipennis (Edwards), Cacopsylla melanoneura Foerster, D. citri, T. remota y T. albiventris) y, en otros casos, PCR en tiempo real (4040. Sjölund MJ, Ouvrard D, Kenyon D, Highet F. Developing an rt-pcr assay for the identification of psyllid species. In: Proceedings Crop Protection in Northern Britain. 2016. p. 4.).

A su vez, Sumner-Kalkun et al. (2424. Sumner-Kalkun JC, Lund MJS, Arnsdorf YM, Carnegie M, Highet F, Ouvrard D, et al. A diagnostic real-time PCR assay for the rapid identification of the tomato-potato psyllid, Bactericera cockerelli (S development of a psyllid barcoding database. PLoS One. 2020;15(3):1-18.) diseñaron y validaron un sistema de diagnóstico de PCR en tiempo real especies-específico (gen de 187 bp de la region ITS2) para detectar todos los estados del ciclo de vida de B. cockerelli (huevos, ninfas y adultos) (Tabla 2). Según estos autores, la principal fortaleza de este nuevo protocolo es que está desarrollado a partir de la integración de la biología molecular y la taxonomía clásica, para lograr construir una base de datos confiable de DNA barcoding de psílidos.

 
Tabla 2.  Cebadores para la identificación molecular de B. cockerelli con PCR en tiempo real. / Primers for the molecular identification of B. cockerelli by real-time PCR.
CebadoresFunciónSecuencia 5’-3’TmLargo (bp)Ref.
Bcoc_JSK2-fforward primerGAGGTCTCCTCATCGTGCGT61252525. Thompson S, Fletcher JD, Ziebell H, Beard S, Panda P, Jorgensen N, et al. First report of ’ Candidatus Liberibacter europaeus’ associated with psyllid infested Scotch broom. New Dis Reports [Internet]. 2013;27:6. Available from: http://www.ndrs.org.uk/article.php?id=027006
Bcoc_JSK2-rreverse primerGGACGAGCATTGCTGCTGC62,223
Bcoc_JSK2-pprobe (FAM-BHQ)GCAAACGCGGCACAAGTACCGCGC70,925
 

BIOLOGÍA Y ECOLOGÍA

B. cockerelli es un insecto holometábolo. El ciclo biológico varía en dependencia de la temperatura y en un rango entre 16 - 23°C. Este insecto logra completar su ciclo en 25 días, aunque el desarrollo óptimo ocurre aproximadamente a 27°C; mientras que, la ovoposición, la eclosión y la supervivencia se reducen a 32°C y cesan a 35°C (66. Butler CD, Trumble JT. The potato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Triozidae): life history, relationship to plant diseases, and management strategies. Terr Arthropod Rev [Internet]. 2012;5(2):87-111. Available from: http://booksandjournals.brillonline.com/content/journals/10.1163/187498312x634266 , 3838. Cerna-Chavez E, Hernández-Bautista O, Ochoa-Fuentes YM, Landeros-Flores J, Aguirre-Uribe LA, Hernández-Juárez A. Morfometría de inmaduros y tablas de vida de Bactericera cockerelli (Hemiptera: Triozidae) de poblaciones del noreste de México. Rev Colomb Entomol. 2018;44(1):53-60., 4242. Yang X-B, Zhang Y-M, Henne DC, Liu T-X. Life Tables of Bactericera cockerelli (Hemiptera: Triozidae) on Tomato Under Laboratory and Field Conditions in Southern Texas . Florida Entomol. 2013;96(3):904-13.) . El período preovoposición es de unos 10 días, con un periodo de ovoposición de 50 días, aproximadamente. La longevidad total de los adultos varía de 20 a 60 días.

Las hembras son capaces de producir entre 300 a 500 huevos durante su vida, con un tiempo de supervivencia superior a los machos (de dos a tres veces), aunque estas características pueden variar según la planta hospedante, la infección por Candidatus Liberibacter solanacearum (CaLso) y el haplotipo del insecto (3939. EPPO. PM 9/25 (1) Bactericera cockerelli and ‘Candidatus Liberibacter solanacearum.’ EPPO Bull [Internet]. 2017 Dec [cited 2019 Jan 8];47(3):513-23. Available from: http://doi.wiley.com/10.1111/epp.12442 , 4242. Yang X-B, Zhang Y-M, Henne DC, Liu T-X. Life Tables of Bactericera cockerelli (Hemiptera: Triozidae) on Tomato Under Laboratory and Field Conditions in Southern Texas . Florida Entomol. 2013;96(3):904-13., 4343. Munyaneza JE. Psyllids as Vectors of Emerging Bacterial Diseases of Annual Crops. Southwest Entomol [Internet]. 2010;35(3):471-7. Available from: http://www.bioone.org/doi/abs/10.3958/059.035.0335 ). La eclosión de los huevos se produce entre tres y siete días después de la ovoposición. Requieren de 356 unidades de calor para completar su ciclo de vida, distribuidos a lo largo de sus diferentes estadios. El ciclo de desarrollo de los estadios ninfales suele depender de la temperatura y la planta hospedante y oscila en un rango de 12 a 24 días (4141. Yang XB, Liu TX. Life History and Life Tables of Bactericera cockerelli (Homoptera : Psyllidae) on Eggplant and Bell Pepper. Environ Entomol. 2009;38(6):1661-7.). Los machos poseen una duración promedio de 20 días; mientras que, la hembra puede vivir hasta 60 días. Una sola generación se puede completar en tres a cinco semanas, dependiendo de la temperatura. El número de generaciones varía, considerablemente, de una región a otra, generalmente de tres a siete; sin embargo, una vez que los psílidos colonizan un área, la ovoposición prolongada hace que las mismas se superpongan, lo que dificulta la distinción entre estas (3838. Cerna-Chavez E, Hernández-Bautista O, Ochoa-Fuentes YM, Landeros-Flores J, Aguirre-Uribe LA, Hernández-Juárez A. Morfometría de inmaduros y tablas de vida de Bactericera cockerelli (Hemiptera: Triozidae) de poblaciones del noreste de México. Rev Colomb Entomol. 2018;44(1):53-60., 4444. Liu D, Trumble JT. Ovipositional preferences , damage thresholds , and detection of the tomato - potato psyllid Bactericera cockerelli ( Homoptera : Psyllidae ) on selected tomato accessions. 2006;197-204. ). Tanto los adultos, como las ninfas, son muy tolerantes al frío, y las ninfas sobreviven a la exposición temporal a temperaturas de -15°C y el 50 % de los adultos que sobreviven a la exposición a -10°C durante más de 24 horas.

Biotipos

De acuerdo con Prager y Trumble (3232. Prager SM, Trumble JT. Psyllids: Biology, Ecology, and Management [Internet]. Sustainable Management of Arthropod Pests of Tomato. Elsevier Inc.; 2018. 163-181 p. Available from: https://doi.org/10.1016/B978-0-12-802441-6.00007-3 ), B. cockerelli es un insecto que puede presentar diferencias genéticas, debido a su amplia expansión geográfica, sobre todo en EUA (4444. Liu D, Trumble JT. Ovipositional preferences , damage thresholds , and detection of the tomato - potato psyllid Bactericera cockerelli ( Homoptera : Psyllidae ) on selected tomato accessions. 2006;197-204. ), lo que refleja la capacidad de este insecto a desarrollar nuevos biotipos, adaptados a las condiciones específicas de temperatura, humedad y tiempo de exposición a la luz del área en que se encuentren, siempre que existan plantas hospederas (4141. Yang XB, Liu TX. Life History and Life Tables of Bactericera cockerelli (Homoptera : Psyllidae) on Eggplant and Bell Pepper. Environ Entomol. 2009;38(6):1661-7.).

Estudios realizados en poblaciones de este insecto encontradas en papa en Baja California y la Costa de California, difieren genéticamente de los psílidos encontrados en el sur de Texas y en el este de México. Estos hallazgos sugieren la existencia de dos haplotipos conocidos como oeste y central, y son los más ampliamente distribuidos. De esta forma, las poblaciones del haplotipo central se encuentran en Colorado, Idaho, Kansas, Nebraska, Nuevo México, Dakota del Norte, Texas, y Wyoming (EUA) y al norte y centro México, además en Honduras, El Salvador y Nicaragua (4545. Swisher KD, Sengoda VG, Dixon J, Echegaray E, Murphy AF, Rondon SI, et al. Haplotypes of the potato psyllid, Bactericera cockerelli, on the wild host plant, Solanum dulcamara, in the pacific Northwestern United States. Am J Potato Res. 2013;90(6):570-7. ); mientras que, las poblaciones del oeste se hallaron en California, Idaho, Oregón, Nuevo México, Dakota del Norte, Washington y Baja México (4545. Swisher KD, Sengoda VG, Dixon J, Echegaray E, Murphy AF, Rondon SI, et al. Haplotypes of the potato psyllid, Bactericera cockerelli, on the wild host plant, Solanum dulcamara, in the pacific Northwestern United States. Am J Potato Res. 2013;90(6):570-7. ).

De acuerdo con Liu y Trumble (77. Liu D, Trumble JT. Comparative fitness of invasive and native populations of the potato psyllid (Bactericera cockerelli). Entomol Exp Appl [Internet]. 2007 Apr;123(1):35-42. Available from: http://onlinelibrary.wiley.com/doi/10.1111/j.1570-7458.2007.00521.x/full ), estos biotipos difieren en varios parámetros del ciclo biológico (sobrevivencia y fecundidad) y en las zonas geográficas de hibernación. Estos autores determinaron, además, que la planta hospedante no tiene influencia en las poblaciones de psílidos del haplotipo Central; mientras que, la preferencia por la planta hospedante y los parámetros de desarrollo pueden variar en el haplotipo Oeste, alcanzando una mayor sobrevivencia en plantas de tomate, aunque alcanzan su máximo desarrollo en pimiento.

Prager et al. (4646. Prager SM, Esquivel I, Trumble JT. Factors influencing host plant choice and larval performance in Bactericera cockerelli. PLoS One. 2014;9(4).) determinaron que ambos biotipos muestran diferencias en la preferencia por la planta hospedante para ovoposición y colonización o establecimiento; el resultado más relevante fue la mayor preferencia por pimiento y tomate que muestra el haplotipo Oeste sobre papa. Sin embargo, un estudio realizado por Mustafa et al. (4747. Mustafa T, Horton DR, Cooper WR, Swisher KD, Zack RS. Interhaplotype Fertility and Effects of Host Plant on Reproductive Traits of Three Haplotypes of Bactericera cockerelli ( Hemiptera : Triozidae ). Environ Entomol. 2015;1-9. ) mostró diferencias entre la biología reproductiva de tres haplotipos del psílido, aunque observaron que puede existir apareamiento entre ellos, pero con consecuencias negativas en la viabilidad de los huevos. Estas interacciones conllevan a pensar que B. cockerelli es un insecto con un comportamiento biológico complejo y que para su manejo se requiere conocer la composición genética de la población existente, las características climáticas de la región y las posibles plantas hospedantes y/o refugios presentes en el área.

Un análisis de fusión de alta resolución del gen mitocondrial de la citocromo oxidasa de B. cockerelli (4646. Prager SM, Esquivel I, Trumble JT. Factors influencing host plant choice and larval performance in Bactericera cockerelli. PLoS One. 2014;9(4)., 4949. Swisher KD, Thompson B, Alexander V, Olsen N, Crosslin JM. Assessing Potato Psyllid Haplotypes in Potato Crops in the Pacific Northwestern United States. Am J Potato Res. 2014;91:485-91.), para analizar las poblaciones del psílido que se presentan en Solanum dulcamara L. durante los meses del verano e invierno en Washington, condujo a la identificación de un tercer biotipo (denominado 'haplotipo del noroeste'), hasta ahora conocido solo desde el Pacífico Noroeste (Nueva Zelanda). Este biotipo de psílido de la papa del noroeste es genéticamente diferente de los biotipos central y occidental y está bastante restringido en rango, aunque se encontraron poblaciones de este insecto en Idaho, Oregón y Washington (EUA).

Posteriormente, en 2014 se identificó el "haplotipo del suroeste" (cuarto haplotipo) y, aunque su presencia es rara, poblaciones de este insecto se encontraron en la región de las montañas rocosas de Colorado y Nuevo México (4949. Swisher KD, Thompson B, Alexander V, Olsen N, Crosslin JM. Assessing Potato Psyllid Haplotypes in Potato Crops in the Pacific Northwestern United States. Am J Potato Res. 2014;91:485-91.).

Mustafa et al. (4747. Mustafa T, Horton DR, Cooper WR, Swisher KD, Zack RS. Interhaplotype Fertility and Effects of Host Plant on Reproductive Traits of Three Haplotypes of Bactericera cockerelli ( Hemiptera : Triozidae ). Environ Entomol. 2015;1-9. ) compararon el comportamiento alimentario y la eficiencia de transmisión de la bacteria Candidatus Liberibacter solanacearum, entre los haplotipos Central, Oeste y Noroeste, mediante los gráficos de penetración eléctrica. Estos autores encontraron que los tres haplotipos exhibían similares frecuencias y duración de la conducta alimentaria, con excepción del haplotipo Oeste, que presentó una duración mayor del periodo de salivación al floema. Además, constataron que los psílidos que pertenecen al haplotipo Noroeste son más efectivos en la transmisión de la bacteria en papa, que los haplotipos Central y Oeste. Aunque este estudio mostró diferencias importantes entre los haplotipos, en cuanto a transmisión y comportamiento alimentario, queda la hipótesis del grado de similaridad en cuanto al proceso de adquisición de la bacteria y la transferencia transovárica en cada haplotipo.

Se encontró, además, que la talla de los insectos puede variar entre los diferentes haplotipos (77. Liu D, Trumble JT. Comparative fitness of invasive and native populations of the potato psyllid (Bactericera cockerelli). Entomol Exp Appl [Internet]. 2007 Apr;123(1):35-42. Available from: http://onlinelibrary.wiley.com/doi/10.1111/j.1570-7458.2007.00521.x/full ). Las alas de los individuos del haplotipo Noroeste son más grandes y la tibia más larga que en los haplotipos Central y Oeste.

A su vez, estudios realizados en cuanto a biología reproductiva entre los diferentes haplotipos demostraron que las hembras del haplotipo Noroeste no producen huevos viables cuando se aparean con machos del haplotipo Oeste; esto pudiera estar provocado por una incompatibilidad citoplasmática causada por la bacteria endosimbionte Wolbachia sp. De acuerdo con estos resultados, los autores plantean que es posible que B. cockerelli no posea una clasificación homogénea, basado en las diferencias existentes entre los variados haplotipos y que, debido a esto, el haplotipo noroeste pudiera representar una población distinta a los demás haplotipos (Central y Oeste); esto sugiere, además, que la infección por Wolbachia puede tener función fundamental en estas diferencias (5050. Cooper WR, Swisher KD, Garczynski SF, Mustafa T, Munyaneza JE, Horton DR. Wolbachia Infection Differs among Divergent Mitochondrial Haplotypes of Bactericera cockerelli (Hemiptera: Triozidae). Ann Entomol Soc Am. 2015;108(2):137-45. ).

ENDOSIMBIONTES ASOCIADOS

Los psílidos, al igual que otros grupos de insectos que pertenecen al suborden Sternorrhyncha (moscas blancas, áfidos y chinches harinosas, entre otros), poseen una asociación obligatoria con diferentes endosimbiontes procariotas que portan en algunas cavidades del cuerpo. Esta asociación es el resultado de una sola infección, seguida de transmisión vertical materna de los endosimbiontes (5151. Baumann P. Biology of Bacteriocyte-Associated Endosymbionts of Plant Sap-Sucking Insects. Annu Rev Microbiol. 2005;59(1):155-89.).

Existen dos tipos de endosimbiontes: primario (P), presente en la gran mayoría de los insectos y es esencial para la sobrevivencia del hospedante que, a su vez, es resultado de una sola infección antigua de un insecto; y secundario (S) o facultativo, que pueden ser más diversos, pues existe una variedad morfológica y no desarrollan una función de importancia en el hospedante (5151. Baumann P. Biology of Bacteriocyte-Associated Endosymbionts of Plant Sap-Sucking Insects. Annu Rev Microbiol. 2005;59(1):155-89.). Asimismo, en numerosas ocasiones, algunos de estos endosimbiontes facultativos suelen ser causantes de enfermedades severas en plantas.

Estudios realizados por Thao (5252. Thao ML, A. Moran N, Abbot P, Brennan EB, Burckhardt DH, Baumann P. Cospeciation of psyllids and their primary prokaryotic endosymbionts. Appl Environ Microbiol. 2000;66(7):2898-905.), mediante la amplificación de fragmentos de ADN que contenían la sección 16S y 23S del ADN ribosomal (ADNr) del endosimbionte primario (P), en 32 especies de psílidos pertenecientes a tres familias y ocho subfamilias, encontraron que se correspondían con una sola infección de un ancestro psílido común a ambas especies y una coespeciación posterior del huésped y del endosimbionte. Se reveló la presencia del endosimbionte primario Candidatus Carsonella ruddii (sp. nov.), indicando que el mismo se transmite por vía materna a través de los óvulos.

Investigaciones llevadas a cabo por Nachappa (5353. Nachappa P, Levy J, Pierson E, Tamborindeguy C. Diversity of endosymbionts in the potato psyllid, Bactericera cockerelli (Hemiptera: Triozidae), vector of zebra chip disease of potato. Curr Microbiol. 2011;62(5):1510-20.), para detectar la microbiota bacteriana en B. cockerelli, hallaron cinco especies bacterianas asociadas al insecto: Candidatus Carsonella ruddii; el endosimbionte facultativo Wolbachia, el patógeno de la planta Candidatus Liberibactter solanacearum (CaLso) (Candidatus Liberibacter psyllaurous ) y dos bacterias transitorias. Los endosimbiontes Candidatus Carsonella ruddii y Wolbachia se detectaron en todos los estadios de vida y sexos de los insectos; mientras que, la infección por CaLso se incrementó según el estadio de vida y la edad del insecto y que, además, son capaces de manipular las defensas de las plantas para beneficiar a su huésped (67).

Las asociaciones establecidas entre patógenos y vectores dan como resultado una compleja red de relaciones que involucra también a toda la comunidad microbiana albergada por el insecto hospedante. Las interacciones entre bacterias pueden ser beneficiosas, competitivas o perjudiciales para los microorganismos involucrados; pueden afectar, dramáticamente, la competencia del insecto vector y, en consecuencia, la propagación de enfermedades. Se demostró que algunos endosimbiontes, ya sean obligados o facultativos, tienen efectos antagónicos en la colonización por patógenos de plantas y producen sustancias antimicrobianas y estimulan la producción de sustancias antimicrobianas por insectos o compitiendo por la infección del hospedante. En otros casos, la exclusión mutua entre endosimbionte y patógeno sugiere una posible influencia perjudicial sobre los fitopatógenos exhibidos por bacterias simbióticas; a la inversa, también están disponibles ejemplos de microbios que mejoran la carga de patógenos. Esas interacciones complejas pueden tener grave impacto en la propagación y el control de patógenos, lo que podría impulsar nuevas estrategias para la contención de importantes enfermedades (5454. Gonella E, Tedeschi R, Crotti E, Alma A. Multiple guests in a single host: interactions across symbiotic and phytopathogenic bacteria in phloem-feeding vectors - a review. Entomol Exp Appl. 2019;167(3):171-85.).

En ese sentido, Hail et al. (5555. Hail D, Dowd SE, Bextine B. Identification And Location Of Symbionts Associated With Potato Psyllid (Bactericera cockerelli) Lifestages. Environ Entomol. 2012;41(1):98-107. ) encontraron especies de Wolbachia, Rhizobium, Gordonia, Mycobacterium y Xanthomonas en este psílido. Según estos autores, el estudio del microbioma del psílido de la papa proporciona conocimiento que permitirá desarrollar estrategias específicas de control biológico.

Si bien varios autores encontraron una gran diversidad en cuanto a S-endosimbiontes en B. cockerelli (5656. Arp AP, Chapman R, Crosslin JM, Bextine B. Low-Level Detection of Candidatus Liberibacter Solanacearum in Bactericera cockerelli (Hemiptera: Triozidae) by 16s rRna Pyrosequencing: Table 1. . Environ Entomol. 2013;42(5):868-73. ), los estudios se encaminaron, principalmente, a la asociación de este psílido con la bacteria Candidatus Liberibacter solanacearum, aunque también se hizo énfasis en las asociaciones con Wolbachia.

Estudios desarrollados por Sengoda et al. (5757. Sengoda VG, Cooper WR, Swisher KD, Henne DC, Munyaneza JE. Latent period and transmission of “Candidatus Liberibacter solanacearum” by the potato psyllid Bactericera cockerelli (Hemiptera: Triozidae). PLoS One. 2014;9(3):1-10. ), indicaron que CaLso requiere un periodo de latencia de dos semanas, a temperaturas que oscilan entre 24 y 28ºC, para multiplicar y colonizar las glándulas salivales del psílido de la papa y para que estos insectos transmitan la bacteria de manera efectiva a las nuevas plantas hospederas. Sugieren, además, que la adquisición y transmisión de CaLso por los psílidos sigue un patrón consistente con un modo de transmisión propagativo, circulatorio y persistente.

Nachappa et al. (5858. Nachappa P, Shapiro AA, Tamborindeguy C. Effect of ‘ Candidatus Liberibacter solanacearum’ on Fitness of Its Insect Vector, Bactericera cockerelli (Hemiptera: Triozidae), on Tomato. Phytopathology [Internet]. 2012 Jan [cited 2019 Jan 8];102(1):41-6. Available from: http://apsjournals.apsnet.org/doi/10.1094/PHYTO-03-11-0084 ) informaron que la bacteria CaLso tiene un impacto negativo en la biología del psílido, aunque no necesariamente tiene que ocurrir en todas las especies de plantas hospederas. Por ejemplo, los efectos positivos de la infección bacteriana en la calidad de la planta hospedante pueden ser detectables solo en especies de plantas de baja calidad o que tienen fuertes respuestas de defensa inducidas, como el tomate. Estos autores manejan la hipótesis que Ca. L. solanacearum puede conferir protección contra el estrés abiótico, contra enemigos naturales y/o resistencia a plaguicidas. De acuerdo con Villagómez et al. (5959. Villagómez CMM, Sicairos C del RL, Valenzuela JÁL, Espinal LAH, Félix SV, Tiznado JAG. Presencia de Candidatus Liberibacter solanacearum en Bactericera cockerelli Sulc asociada con enfermedades en tomate , chile y papa. Rev Mex Cienc Agríc. 2018;9(3):499-509. ), la presencia de CaLso en muestras de huevecillos de B. cockerelli sugiere que la transmisión de la bacteria es transovárica.

Hasta ahora, se describieron seis haplotipos de CaLso, basado en polimorfismos de un solo nucleótido en la región del gen de la proteína ribosómica 50S rplJ / rplL, la región espaciadora intergénica 16S-23S rRNA y el 16S rRNA (6060. Nelson WR, Sengoda VG, Alfaro-Fernandez AO, Font MI, Crosslin JM, Munyaneza JE. A new haplotype of “Candidatus Liberibacter solanacearum” identified in the Mediterranean region. Eur J Plant Pathol [Internet]. 2013 Apr 7 [cited 2019 Jan 8];135(4):633-9. Available from: http://link.springer.com/10.1007/s10658-012-0121-3 ). Dos están asociados con especies solanáceas (haplotipos A y B) presentes en América del Norte y Central y son transmitidos por B. cockerelli; haplotipo A en Nueva Zelanda, haplotipo C en el noreste de Europa y haplotipos D y E en el sureste de Europa y la región del Mediterráneo y están asociados con cultivos de zanahoria y otras apiaceas. El sexto haplotipo (Haplotipo U) se encontró en ejemplares del psílido Trioza urticae (L) colectado en Urtica dioica, (Urticaceae), en las regiones de Tavastia Proper y Satakunta en Finlandia y, posteriormente, en Alemania (2323. Haapalainen M, Wang J, Latvala S, Lehtonen MT, Pirhonen M, Nissinen AI. Genetic Variation of ‘Candidatus Liberibacter solanacearum’ Haplotype C and Identification of a Novel Haplotype from Trioza urticae and Stinging Nettle. Phytopathology [Internet]. 2018 Aug [cited 2019 Jan 8];108(8):925-34. Available from: https://apsjournals.apsnet.org/doi/10.1094/PHYTO-12-17-0410-R ). En 2019 se informaron otros tres nuevos haplotipos de la bacteria F (6161. Grimm KDS, Garczynski SF. Identification of a New Haplotype of ‘ Candidatus Liberibacter solanacearum ’ in Solanum tuberosum. 2019;103(3):468-74. ), G (6262. Mauck K, Sun P. New Ca . Liberibacter psyllaurous haplotype resurrected from a 49-year-old specimen of Solanum umbelliferum: a native host of the psyllid vector. 2019;(December). ) y H (6363. Haapalainen M, Latvala S, Wickström A, Wang J, Pirhonen M, Nissinen AI. A novel haplotype of ‘ Candidatus Liberibacter solanacearum ’ found in Apiaceae and Polygonaceae family plants. Eur J Plant Pathol. 2019;1-11. ), lo que demuestra la gran variedad genética y adaptabilidad de esta bacteria fitopatógena.

El riesgo de trasmisión cruzada, por las diferentes especies de psílidos vectores de esta bacteria a otras plantas, fue ampliamente estudiado en los últimos años. En ese sentido, Munyaneza et al. (6464. Munyaneza JE, Mustafa T, Fisher TW, Sengoda VG, Horton DR. Assessing the likelihood of transmission of Candidatus Liberibacter solanacearum to carrot by potato psyllid, Bactericera cockerelli (Hemiptera: Triozidae). Rashed A, editor. PLoS One [Internet]. 2016 Aug 15 [cited 2019 Jan 8];11(8). Available from: https://dx.plos.org/10.1371/journal.pone.0161016 ) sugirieron que el riesgo de infección por CaLso y la propagación entre cultivos de solanaceas y Apiaceae infestados de B. cockerelli es insignificante en condiciones de campo.

Otro estudio, desarrollado por Antolinez et al. (6565. Antolinez CA, Fereres A, Moreno A. Risk assessment of ‘Candidatus Liberibacter solanacearum’ transmission by the psyllids Bactericera trigonica and B . tremblayi from Apiaceae crops to potato. Nature/Scientific Reports [Internet]. 2017;7(November 2016):1-10. Available from: http://dx.doi.org/10.1038/srep45534 ), mostró que el riesgo de transmisión de CaLso de Apiaceae (haplotipo E) a S. tuberosum por B. trigonica es muy bajo y que B. tremblayi es un vector poco probable de CaLso, ya que es capaz de adquirir la bacteria, pero no de transmitirla. Por su parte, Teresani et al. (6666. Teresani GR, Hernández E, Bertolini E, Siverio F, Moreno A, Fereres A, et al. Transmission of ‘Candidatus Liberibacter solanacearum’ by Bactericera trigonica Hodkinson to vegetable hosts. Spanish J Agric Res. 2017;15(4):11p. https://doi.org/10.5424/sjar/2017154-10762 ) determinaron que B. trigonica es el vector de la bacteria CaLso para zanahoria y el apio, pero que en cultivos de solanáceas (papa y tomate) la transmisión de esta bacteria por B. trigonica es muy baja, aunque pudieran darse algunos casos en que se comporte como vector ocasional, sobre todo cuando el hospedante preferencial no se encuentre y sea otro cultivo afín el único disponible; también, cuando la población de psílidos sea muy elevada y la acción de los enemigos naturales escasa.

Existe otra especie de psílido en Europa, Bactericera nigricornis, que tiene capacidad para colonizar papa. Este insecto es capaz de adquirir e inocular la bacteria de papa a papa, aunque la tasa de transmisión es muy baja (tasa de transmisión de 1 %). Moreno1

Dr Aranzazu Moreno. Instituto de Ciencias Agrarias (ICA, CSIC), Consejo Superior de Investigaciones Científicas (CSIC), C/Serrano 115 Dpdo 28006 Madrid, España. 2021. Comunicación Personal.

refiere que, a pesar de la capacidad de B. nigricornis para transmitir CaLsol a los cultivos de papa, su eficiencia como vector de CaLsol es muy baja y la transmisión de bacterias por esta especie de psílido no es una amenaza real para los cultivos de papa en la situación actual en Europa. Estos autores insisten que, a pesar de este comportamiento, es muy recomendable monitorear las poblaciones del insecto como medida preventiva para evitar posibles brotes en aquellas áreas donde está presente.

Como se ha discutido con anterioridad, los psílidos son insectos que muestran un amplio rango de adaptabilidad a diferentes hospedantes y zonas climáticas, con una capacidad vectorial elevada, lo cual puede constituir un riesgo para la agricultura en numerosos países de la región y otros continentes. De ahí que el conocimiento de sus características biológicas, taxonómicas y capacidad vectorial son fundamentales para la evaluación de posibles hospedantes y zonas de establecimiento en Cuba y otros países del mundo. Por tal motivo, es de vital importancia conocer el movimiento de plantas de riesgo, mantener un monitoreo y vigilancia de esta plaga para evitar y/o manejar posibles problemas fitosanitarios a tiempo.

 
 
 
AGRADECIMIENTOS

Los autores quieren agradecer la colaboración del profesor Dr. Paul Walker y Sra. Raylea Rowbottom del Instituto de Agricultura de Tasmania / Universidad de Tasmania, por permitir la utilización de las imágenes para la identificación de Bactericera cockerelli. A la DrC. Mayra G. Rodríguez Hernández, por la revisión y las sugerencias realizadas al documento.

 

REFERENCIAS
1. ONU. Creciendo a un ritmo menor, se espera que la población mundial alcanzará 9.700 millones en 2050 y un máximo de casi 11.000 millones alrededor de 2100: Informe de la ONU. Perspect la Población Mund 2019 [Internet]. 2019;1:1-4. Available from: https://population.un.org/wpp/Publications/Files/WPP2019_PressRelease_ES.pdf
2. Karuppaiah V, Sujayanad GK. Impact of climate change on population dynamics of insect pests. World J Agric Sci [Internet]. 2012;8(3):240-6. Available from: https://www.researchgate.net/publication/259240426
3. Bebber DP, Ramotowski MAT, Gurr SJ. Crop pests and pathogens move polewards in a warming world. Nat Clim Chang [Internet]. 2013;3(11):985-8. Available from: http://dx.doi.org/10.1038/nclimate1990
4. Syfert MM, Serbina L, Burckhardt D, Knapp S, Percy DM. Emerging new crop pests: Ecological modelling and analysis of the South American potato psyllid Russelliana solanicola (Hemiptera: Psylloidea) and its wild relatives. PLoS One. 2017;12(1).
5. Munyaneza JE, Henne DC. Leafhopper and Psyllid Pests of Potato [Internet]. Insect Pests of Potato. Elsevier Inc.; 2013. 65-102 p. Available from: http://dx.doi.org/10.1016/B978-0-12-386895-4.00004-1
6. Butler CD, Trumble JT. The potato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Triozidae): life history, relationship to plant diseases, and management strategies. Terr Arthropod Rev [Internet]. 2012;5(2):87-111. Available from: http://booksandjournals.brillonline.com/content/journals/10.1163/187498312x634266
7. Liu D, Trumble JT. Comparative fitness of invasive and native populations of the potato psyllid (Bactericera cockerelli). Entomol Exp Appl [Internet]. 2007 Apr;123(1):35-42. Available from: http://onlinelibrary.wiley.com/doi/10.1111/j.1570-7458.2007.00521.x/full
8. Butler CD, Walker GP, Trumble JT. Feeding disruption of potato psyllid, Bactericera cockerelli, By imidacloprid as measured by electrical penetration graphs. Entomol Exp Appl. 2012;142(3):247-57.
9. Haapalainen M. Biology and epidemics of Candidatus Liberibacter species, psyllid-transmitted plant-pathogenic bacteria. Ann Appl Biol [Internet]. 2014 Sep [cited 2019 Jan 8];165(2):172-98. Available from: http://doi.wiley.com/10.1111/aab.12149
10. Burckhardt DH. Psylloid pest of temperate and subtropical crop and ornamental plants (Hemiptera, Psylloidea):A review. Trends Agril Sci. 1994;2:173-86.
11. Castillo C, Fu Z, Burckhardt D. First record of the tomato potato Psyllid Bactericera Cockerelli from South America. Bull Insectology. 2019;72(1):85-91.
12. Munyaneza JE, Crosslin JM, Upton JE. Association of Bactericera cockerelli (Homoptera: Psyllidae) with “Zebra Chip,” a New Potato Disease in Southwestern United States and Mexico. J Econ Entomol [Internet]. 2007;100(3):656-63. Available from: http://openurl.ingenta.com/content/xref?genre=article&issn=0022-0493&volume=100&issue=3&spage=656
13. Crosslin JM, Munyaneza JE, Brown JK, Liefting LW. Potato Zebra Chip Disease: A Phytopathological Tale. Plant Heal Prog [Internet]. 2010 Jan [cited 2019 Jan 8];11(1):33. Available from: https://apsjournals.apsnet.org/doi/10.1094/PHP-2010-0317-01-RV
14. Borges KM, Cooper WR, Garczynski SF, Thinakaran J, Jensen AS, Horton DR, et al. “Candidatus Liberibacter solanacearum” associated with the psyllid, Bactericera maculipennis (Hemiptera: Triozidae). Environ Entomol. 2017;46(2):210-6.
15. Castillo CI, Jensen AS, Snyder WE. Checklist of the Psylloidea (Hemiptera) of the U . S . Pacific Northwest. PROC ENTOMOL SOC WASH. 2016;118(4):498-509.
16. Munyaneza JE, Fisher TW, Sengoda VG, Garczynski SF, Nissinen A, Lemmetty A. Association of “Candidatus Liberibacter solanacearum” With the Psyllid, Trioza apicali (Hemiptera: Triozidae) in Europe. J Econ Entomol [Internet]. 2010;103(4):1060-70. Available from: https://academic.oup.com/jee/article-lookup/doi/10.1603/EC10027
17. Munyaneza JE, Henne DC. Leafhopper and Psyllid Pests of Potato [Internet]. Insect Pests of Potato. Elsevier Inc.; 2013 [cited 2019 Jan 8]. 65-102 p. Available from: https://linkinghub.elsevier.com/retrieve/pii/B9780123868954000041
18. Morris J, Shiller J, Mann R, Smith G, Yen A, Rodoni B. Novel ‘Candidatus Liberibacter’ species identified in the Australian eggplant psyllid, Acizzia solanicola. Microb Biotechnol [Internet]. 2017 Jul [cited 2019 Jan 8];10(4):833-44. Available from: http://doi.wiley.com/10.1111/1751-7915.12707
19. Salazar LF. Emerging and re-emerging potato diseases in the Andes. Potato Res. 2006;49(1):43-7.
20. Kuhn; TM de A, Burckhardt D, Queiroz DL de, Teresani GR, Lopes JRS. Occurrence of Russelliana solanicola Tuthill, 1959 (Hemiptera: Psyllidae), potencial vector of "Candidatus Liberibacter solanacearum" on carrot crops. 2016;1959:2016.
21. Syfert MM, Serbina L, Burckhardt D, Knapp S, Percy DM. Emerging new crop pests: Ecological modelling and analysis of the South American potato psyllid Russelliana solanicola (Hemiptera: Psylloidea) and its wild relatives. PLoS One [Internet]. 2017;12(1):1-18. Available from: http://dx.doi.org/10.1371/journal.pone.0167764
22. Brlansky RH, Chung KR, Rogers ME. 2006 Florida Citrus Pest Management Guide : Huanglongbing ( Citrus Greening ) 1. 2006;1-3.
23. Haapalainen M, Wang J, Latvala S, Lehtonen MT, Pirhonen M, Nissinen AI. Genetic Variation of ‘Candidatus Liberibacter solanacearum’ Haplotype C and Identification of a Novel Haplotype from Trioza urticae and Stinging Nettle. Phytopathology [Internet]. 2018 Aug [cited 2019 Jan 8];108(8):925-34. Available from: https://apsjournals.apsnet.org/doi/10.1094/PHYTO-12-17-0410-R
24. Sumner-Kalkun JC, Lund MJS, Arnsdorf YM, Carnegie M, Highet F, Ouvrard D, et al. A diagnostic real-time PCR assay for the rapid identification of the tomato-potato psyllid, Bactericera cockerelli (S development of a psyllid barcoding database. PLoS One. 2020;15(3):1-18.
25. Thompson S, Fletcher JD, Ziebell H, Beard S, Panda P, Jorgensen N, et al. First report of ’ Candidatus Liberibacter europaeus’ associated with psyllid infested Scotch broom. New Dis Reports [Internet]. 2013;27:6. Available from: http://www.ndrs.org.uk/article.php?id=027006
26. Raddadi N, Gonella E, Camerota C, Pizzinat A, Tedeschi R, Crotti E, et al. “Candidatus Liberibacter europaeus” sp. nov. that is associated with and transmitted by the psyllid Cacopsylla pyri apparently behaves as an endophyte rather than a pathogen. Environ Microbiol. 2011;13(2):414-26.
27. Jarausch B, Jarausch W. Establishment of a permanent rearing of Cacopsylla picta (Hemiptera: Psylloidea), the main vector of “Candidatus Phytoplasma mali” in Germany. J Pest Sci (2004). 2014;87(3):459-67.
28. Orlovskis Z, Canale MC, Thole V, Pecher P, Lopes JR, Hogenhout SA. ScienceDirect Insect-borne plant pathogenic bacteria : getting a ride goes beyond physical contact. Curr Opin Insect Sci. 2015;9:16-23.
29. Fialová R, Navrátil M, Lauterer P, Navrkalová V. “Candidatus Phytoplasma prunorum”: The phytoplasma infection of cacopsylla pruni from apricot orchards and from overwintering habitats in Moravia (Czech Republic). Bull Insectology. 2007;60(2):183-4.
30. Alemán J, Baños H, Ravelo J. Diaphorina citri y la enfermedad Huanglongbing: Una combinación destructiva para la producción citrícola. Rev Protección Veg. 2007;22(3):154-65.
31. Ouvrard D, Chalise P, Percy DM. Host-plant leaps versus host-plant shuffle: A global survey reveals contrasting patterns in an oligophagous insect group (Hemiptera, Psylloidea). Syst Biodivers. 2015;13(5):434-54.
32. Prager SM, Trumble JT. Psyllids: Biology, Ecology, and Management [Internet]. Sustainable Management of Arthropod Pests of Tomato. Elsevier Inc.; 2018. 163-181 p. Available from: https://doi.org/10.1016/B978-0-12-802441-6.00007-3
33. Burckhardt D, Lauterer P. A taxonomic reassessment of the triozid genus Bactericera (Hemiptera: Psylloidea). J Nat Hist. 1997;31(1):99-153.
34. Hodkinson ID. Life cycle variation and adaptation in jumping plant lice ( Insecta : Hemiptera : Psylloidea ): a global synthesis. 2009;43(January):65-179.
35. Ouvrard D. Psyl’list - The World Psylloidea Database. [Internet]. 2020. 2020 [cited 2020 Jun 24]. Available from: http://www.hemiptera-databases.com/psyllist
36. University of Tasmania TI of A (TIA). Key to distinguish the tomato-potato psyllid from other psyllids. 2017.
37. Wallis RL. Ecological studies on the Potato psyllid as pest of potatoes. USDA Tech Bull. 1955;(1107):1-24.
38. Cerna-Chavez E, Hernández-Bautista O, Ochoa-Fuentes YM, Landeros-Flores J, Aguirre-Uribe LA, Hernández-Juárez A. Morfometría de inmaduros y tablas de vida de Bactericera cockerelli (Hemiptera: Triozidae) de poblaciones del noreste de México. Rev Colomb Entomol. 2018;44(1):53-60.
39. EPPO. PM 9/25 (1) Bactericera cockerelli and ‘Candidatus Liberibacter solanacearum.’ EPPO Bull [Internet]. 2017 Dec [cited 2019 Jan 8];47(3):513-23. Available from: http://doi.wiley.com/10.1111/epp.12442
40. Sjölund MJ, Ouvrard D, Kenyon D, Highet F. Developing an rt-pcr assay for the identification of psyllid species. In: Proceedings Crop Protection in Northern Britain. 2016. p. 4.
41. Yang XB, Liu TX. Life History and Life Tables of Bactericera cockerelli (Homoptera : Psyllidae) on Eggplant and Bell Pepper. Environ Entomol. 2009;38(6):1661-7.
42. Yang X-B, Zhang Y-M, Henne DC, Liu T-X. Life Tables of Bactericera cockerelli (Hemiptera: Triozidae) on Tomato Under Laboratory and Field Conditions in Southern Texas . Florida Entomol. 2013;96(3):904-13.
43. Munyaneza JE. Psyllids as Vectors of Emerging Bacterial Diseases of Annual Crops. Southwest Entomol [Internet]. 2010;35(3):471-7. Available from: http://www.bioone.org/doi/abs/10.3958/059.035.0335
44. Liu D, Trumble JT. Ovipositional preferences , damage thresholds , and detection of the tomato - potato psyllid Bactericera cockerelli ( Homoptera : Psyllidae ) on selected tomato accessions. 2006;197-204.
45. Swisher KD, Sengoda VG, Dixon J, Echegaray E, Murphy AF, Rondon SI, et al. Haplotypes of the potato psyllid, Bactericera cockerelli, on the wild host plant, Solanum dulcamara, in the pacific Northwestern United States. Am J Potato Res. 2013;90(6):570-7.
46. Prager SM, Esquivel I, Trumble JT. Factors influencing host plant choice and larval performance in Bactericera cockerelli. PLoS One. 2014;9(4).
47. Mustafa T, Horton DR, Cooper WR, Swisher KD, Zack RS. Interhaplotype Fertility and Effects of Host Plant on Reproductive Traits of Three Haplotypes of Bactericera cockerelli ( Hemiptera : Triozidae ). Environ Entomol. 2015;1-9.
48. Swisher KD, Munyaneza JE, Crosslin JM. High Resolution Melting Analysis of the Cytochrome Oxidase I Gene Identifies Three Haplotypes of the Potato Psyllid in the United States. Environ Entomol [Internet]. 2012 Aug 1 [cited 2019 Jan 8];41(4):1019-28. Available from: https://academic.oup.com/ee/article-lookup/doi/10.1603/EN12066
49. Swisher KD, Thompson B, Alexander V, Olsen N, Crosslin JM. Assessing Potato Psyllid Haplotypes in Potato Crops in the Pacific Northwestern United States. Am J Potato Res. 2014;91:485-91.
50. Cooper WR, Swisher KD, Garczynski SF, Mustafa T, Munyaneza JE, Horton DR. Wolbachia Infection Differs among Divergent Mitochondrial Haplotypes of Bactericera cockerelli (Hemiptera: Triozidae). Ann Entomol Soc Am. 2015;108(2):137-45.
51. Baumann P. Biology of Bacteriocyte-Associated Endosymbionts of Plant Sap-Sucking Insects. Annu Rev Microbiol. 2005;59(1):155-89.
52. Thao ML, A. Moran N, Abbot P, Brennan EB, Burckhardt DH, Baumann P. Cospeciation of psyllids and their primary prokaryotic endosymbionts. Appl Environ Microbiol. 2000;66(7):2898-905.
53. Nachappa P, Levy J, Pierson E, Tamborindeguy C. Diversity of endosymbionts in the potato psyllid, Bactericera cockerelli (Hemiptera: Triozidae), vector of zebra chip disease of potato. Curr Microbiol. 2011;62(5):1510-20.
54. Gonella E, Tedeschi R, Crotti E, Alma A. Multiple guests in a single host: interactions across symbiotic and phytopathogenic bacteria in phloem-feeding vectors - a review. Entomol Exp Appl. 2019;167(3):171-85.
55. Hail D, Dowd SE, Bextine B. Identification And Location Of Symbionts Associated With Potato Psyllid (Bactericera cockerelli) Lifestages. Environ Entomol. 2012;41(1):98-107.
56. Arp AP, Chapman R, Crosslin JM, Bextine B. Low-Level Detection of Candidatus Liberibacter Solanacearum in Bactericera cockerelli (Hemiptera: Triozidae) by 16s rRna Pyrosequencing: Table 1. . Environ Entomol. 2013;42(5):868-73.
57. Sengoda VG, Cooper WR, Swisher KD, Henne DC, Munyaneza JE. Latent period and transmission of “Candidatus Liberibacter solanacearum” by the potato psyllid Bactericera cockerelli (Hemiptera: Triozidae). PLoS One. 2014;9(3):1-10.
58. Nachappa P, Shapiro AA, Tamborindeguy C. Effect of ‘ Candidatus Liberibacter solanacearum’ on Fitness of Its Insect Vector, Bactericera cockerelli (Hemiptera: Triozidae), on Tomato. Phytopathology [Internet]. 2012 Jan [cited 2019 Jan 8];102(1):41-6. Available from: http://apsjournals.apsnet.org/doi/10.1094/PHYTO-03-11-0084
59. Villagómez CMM, Sicairos C del RL, Valenzuela JÁL, Espinal LAH, Félix SV, Tiznado JAG. Presencia de Candidatus Liberibacter solanacearum en Bactericera cockerelli Sulc asociada con enfermedades en tomate , chile y papa. Rev Mex Cienc Agríc. 2018;9(3):499-509.
60. Nelson WR, Sengoda VG, Alfaro-Fernandez AO, Font MI, Crosslin JM, Munyaneza JE. A new haplotype of “Candidatus Liberibacter solanacearum” identified in the Mediterranean region. Eur J Plant Pathol [Internet]. 2013 Apr 7 [cited 2019 Jan 8];135(4):633-9. Available from: http://link.springer.com/10.1007/s10658-012-0121-3
61. Grimm KDS, Garczynski SF. Identification of a New Haplotype of ‘ Candidatus Liberibacter solanacearum ’ in Solanum tuberosum. 2019;103(3):468-74.
62. Mauck K, Sun P. New Ca . Liberibacter psyllaurous haplotype resurrected from a 49-year-old specimen of Solanum umbelliferum: a native host of the psyllid vector. 2019;(December).
63. Haapalainen M, Latvala S, Wickström A, Wang J, Pirhonen M, Nissinen AI. A novel haplotype of ‘ Candidatus Liberibacter solanacearum ’ found in Apiaceae and Polygonaceae family plants. Eur J Plant Pathol. 2019;1-11.
64. Munyaneza JE, Mustafa T, Fisher TW, Sengoda VG, Horton DR. Assessing the likelihood of transmission of Candidatus Liberibacter solanacearum to carrot by potato psyllid, Bactericera cockerelli (Hemiptera: Triozidae). Rashed A, editor. PLoS One [Internet]. 2016 Aug 15 [cited 2019 Jan 8];11(8). Available from: https://dx.plos.org/10.1371/journal.pone.0161016
65. Antolinez CA, Fereres A, Moreno A. Risk assessment of ‘Candidatus Liberibacter solanacearum’ transmission by the psyllids Bactericera trigonica and B . tremblayi from Apiaceae crops to potato. Nature/Scientific Reports [Internet]. 2017;7(November 2016):1-10. Available from: http://dx.doi.org/10.1038/srep45534
66. Teresani GR, Hernández E, Bertolini E, Siverio F, Moreno A, Fereres A, et al. Transmission of ‘Candidatus Liberibacter solanacearum’ by Bactericera trigonica Hodkinson to vegetable hosts. Spanish J Agric Res. 2017;15(4):11p. https://doi.org/10.5424/sjar/2017154-10762
NOTA

Dr Aranzazu Moreno. Instituto de Ciencias Agrarias (ICA, CSIC), Consejo Superior de Investigaciones Científicas (CSIC), C/Serrano 115 Dpdo 28006 Madrid, España. 2021. Comunicación Personal.

 
 

Recibido: 01/08/2020

Aceptado: 25/02/2021

 
 

Conflicto de intereses: Los autores declaran que no existe conflicto de intereses

Contribución de los autores: Heyker L. Baños Díaz: realizó contribuciones en el análisis e interpretación de los artículos que conforman la revisión. Participó en la búsqueda de información, en el diseño, revisión y redacción del artículo. Lizandra Guerra Arzuaga: participó en la búsqueda de información y redacción del borrador del artículo. Alberto Castiel Fereres: Líder del Grupo de Insectos vectores del ICA-CSIC Madrid, realizó importantes contribuciones en el análisis e interpretación de los artículos que conforman la revisión. Hizo la revisión crítica del contenido de los borradores del artículo y la aprobación del documento final.

 

Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons


 

Enlaces refback

  • No hay ningún enlace refback.