Artículo Original

  

http://opn.to/a/xfL7h

Caracterización microbiológica y genotípica de cepas de Pasteurella multocida asociadas al síndrome respiratorio cunícola

Microbiological and genotypic characterization of Pasteurella mutocida strains associated with the cunicular respiratory syndrome


RESUMEN

Pasteurella multocida es una bacteria Gram negativa que se asocia a síndromes respiratorios en diferentes especies de animales. Esta bacteria presenta una alta heterogeneidad intraespecie, donde es posible encontrar diferentes biovares, cinco serogrupos capsulares con diferencias en los factores de virulencia y la expresión de la patogenicidad, así como en los perfiles de susceptibilidad a los antibióticos y la capacidad para la formación de biopelículas. El objetivo del presente trabajo es la caracterización de cepas de P. multocida recobradas de conejos. Se realizó la identificación microbiológica, la genoserotipificación capsular y la detección de genes que participan en la expresión de factores de virulencia. Se determinó la susceptibilidad a varias familias de antibióticos y la capacidad de producir biopelículas in vitro. Se confirmó que las cepas pertenecen a la especie P. multocida subespecie multocida biotipo 1, al tipo capsular A. Las cepas fueron positivas a la detección de fragmentos de genes de los locis relacionados con la biogénesis de fimbrias, neurominidasa y proteínas de membrana externa, que constituyen factores de virulencia, específicamente para la colonización e interacción con el hospedero. Las cepas revelaron multirresistencia y solo dos mostraron moderada capacidad para la producción de biopelículas. La caracterización de estas cepas esclarece aspectos epidemiológicos relacionados con el serogrupo capsular, que son de utilidad para la obtención de candidatos vacunales y contribuir a la prevención o profilaxis de infecciones por esta bacteria, por lo que el presente trabajo constituye una contribución al control de esta infección en conejos.

Palabras clave: 

biopelículas; factores de virulencia; Pasteurella multocida; resistencia antimicrobiana; serogrupo capsular.

ABSTRACT

Pasteurella multocida is a Gram-negative bacterium associated with respiratory syndromes in different species of animals such as pigs, birds, rabbits, cats, and dogs. This bacterium presents high intra-species heterogeneity, where it is possible to find different biovars, five capsular serogroups with differences in virulence factors and the expression of pathogenicity, as well as profiles of susceptibility to antibiotics and the capacity for the formation of biofilms. The objective of this work is to characterize of P. multocida strains isolated from rabbits. The microbiological identification, capsular genoserotyping and the detection of genes involved in the virulence factors were carried out. Susceptibility to several families of antibiotics and the ability to produce biofilms in vitro were determined. It was confirmed that the strains belong to the species P. multocida subspecies multocida biotype 1 capsular A serogroup. The strains were positive to the detection of loci gene fragments related to the biogenesis of fimbrias, neurominidase and outer membrane proteins, which constitute virulence factors, specifically for colonization and interaction with the host. The strains revealed multi-resistance and only two of them showed moderate capacity for the production of biofilms. The characterization of these strains clarifies the epidemiological aspects related to the capsular serogroup, which are useful for obtaining vaccine candidates and contribute to the prevention or prophylaxis of infections by this bacterium, thus the present work contributes to the control of this infection in rabbits.

Key words: 

biofilms; virulence factors; Pasteurella multocida; antimicrobial resistance; capsular serogroup.


Los conejos son animales muy sensibles a situaciones de estrés, a los agentes patógenos y a cualquier factor que altere su medio ambiente. En esta especie animal suelen ocurrir procesos infecciosos en los tractos respiratorio y digestivo, que comprometen su salud y la productividad (1). Las infecciones clínicas respiratorias en los conejos se consideran, al igual que en otras especies, como un síndrome, pues en su origen participan agentes microbianos con elementos de virulencia en interacción con factores predisponentes que favorecen la susceptibilidad de hospederos a estas infecciones (2,3).

Pasteurella multocida es un patógeno oportunista, de amplia distribución mundial tanto en salud animal como en humanos, que se asocia a procesos respiratorios en varias especies de animales, incluyendo a la cunicultura (4). Según la naturaleza y la composición del material capsular, se describen cinco serogrupos de P. multocida (5). Los serotipos de P. multocida suelen ser específicos para las diferentes especies de animales que coloniza o infecta esta bacteria (5,6). En la especie aviar la presentación clínica producida por P. multocida se denomina cólera aviar y las cepas corresponden al serotipo capsular A (6). En el ganado bovino se nombra septicemia hemorrágica y ocurre por cepas correspondientes al serotipo B (7,8,9), mientras que en el porcino se denomina rinitis atrófica y/o neumonía en cerdos y suelen estar presentes los serotipos A y D (10). Las infecciones por P. multocida en humanos pueden ocurrir, usualmente, a partir de mordeduras de perros y gatos que provocan linfangitis en pacientes inmunocomprometidos, así como meningitis y endocarditis (4,11). En conejos la pasteurelosis se considera una de las infecciones más comunes, causante del síndrome respiratorio o coriza y puede causar la muerte del animal (3,12).

En conejos, se informa con mayor frecuencia el tipo capsular A, aunque también se han aislado tipo D y, en menor grado, tipo F (13). En animales empleados en la experimentación, P. multocida representa el patógeno respiratorio más importante, su presencia influye de forma negativa en los resultados de las diferentes investigaciones en las que se emplean estos animales (14,15).

Diversos son los factores relacionados con la virulencia de P. multocida, dentro de los que se incluye la cápsula o polisacárido capsular, que confiere resistencia a la fagocitosis (16,17). Otros factores de virulencia son las sialidasa o neuraminidasa NanH y NanB, que liberan el ácido siálico de diferentes compuestos del hospedero (18); se producen por todos los tipos capsulares de esta especie, excepto por el tipo capsular F (19).

La fimbria o pili se asocia a la colonización de superficies epiteliales del hospedero (17). Las proteínas de membrana externa (de sus siglas en inglés outer membrane protein OMP) desempeñan un importante papel en las interacciones patógeno-hospedero (18).

La antibioterapia y las vacunas son estrategias para el control de las infecciones producidas por P. multocida. En ambos casos es necesario conocer las características de las cepas que prevalecen en cada localidad para la aplicación de antibióticos con efectividad comprobada in vitro (20,21,22). Cuando se emplean vacunas comerciales, la protección cruzada es una limitación en especies donde existe alta heterogeneidad genética; en tal sentido, se recomienda el uso de vacunas autógenas (23), pero su elaboración requiere la identificación y la caracterización de las cepas para una selección correcta.

El presente trabajo tiene como objetivo caracterizar cepas de P. multocida aisladas de conejos en cuanto al serotipo capsular, factores de virulencia, susceptibilidad antimicrobiana y formación de biopelículas.

Se seleccionaron 11 aislados conservados a -70o C en solución de leche descremada al 10 %, en el cepario del Centro Nacional de Producción de Animales de Laboratorio (CENPALAB). Se obtuvieron en el periodo de 1995-2005, de conejos de la colonia del CENPALAB con síndrome respiratorio y de animales aparentemente sanos. Los aislados se conservaron bajo el criterio de poseer características presuntivas morfológicas y tintoriales con la especie P. multocida.

Los aislados se cultivaron y se seleccionó una colonia aislada de cada uno para su multiplicación e identificación, acorde a características culturales, morfológicas (colonias medianas, mucoides, blancas grisáceas), tintoriales (cocobacilos Gram negativos). Se realizó la prueba oxidasa, cultivo en agar Mac Conkey (Biocen) y pruebas bioquímicas según sistema comercial Api20NE (Biomerieux).

La determinación de los biovares se realizó mediante pruebas bioquímicas, que agrupan a las cepas de P. multocida en 13 biovares (1-10 y 12-14). Esta metodología incluye el comportamiento frente a siete azúcares: glucosa, trehalosa, xilosa, dulcitol, sorbitol, lactosa y manitol, además de la prueba de la descarboxilación de la ornitina (ODC) y la producción de ureasa (24,25).

Para la extracción de ADN se partió de cultivos de 24 horas de cada cepa. Una vez identificadas se tomó un fragmento, con puntas nuevas y estériles, de una colonia aislada y se introdujo en 50 μL de agua estéril libre de nucleasas. La lisis se realizó por shock térmico, al someter la suspensión a 100ºC por cinco minutos y la posterior incubación a -20ºC durante 10 minutos. A continuación, se centrifugó a 5000 g por cinco minutos; el sobrenadante se transfirió a un tubo eppendorf y se conservó a -20ºC hasta su posterior utilización.

La confirmación de la especie se realizó con cebadores específicos para la misma (KMT1T7 y KMT1SP6) (5); seguidamente se realizó la genoserotipificación con cebadores específicos para los serogrupos capsulares AhyaD-hyaC (5). La determinación de factores de virulencia, como la toxina dermonecrótica (tox), fimbrias (Fim 4, ptfA), factor de colonización (Nan H, Nan B) y proteína de membrana externa (omp) se realizó también mediante ensayos de PCR basados en la amplificación de fragmentos de ácidos nucleicos que forman parte de los locis vinculados a la biogénesis de estos marcadores y se siguieron las condiciones descritas por Ewers et al. (26).

La secuencia de los cebadores, la talla de los amplicones y los programas de amplificación se describen en la Tabla 1.

Tabla 1. 

Condiciones de los ensayos de PCR para la detección de genes que codifican para la biogénesis de la cápsula y factores de virulencia de Pasteurella multocida./ Conditions for PCR assay for detecting genes coding for capsule biogenesis and virulence factors of Pasteurella multocida.

PrimerSecuencia de Cebadores (5’-3’)Tamaño del amplicón (pb)Condiciones PCR (°C/s)
KMT1T7GCTGTAAACGAACTCGCCAC46094/3050/4072/60
KMT1SP6ATCCGCTATTTACCCAGTGG
AhyaD-hyaC GATGCCAAAATCGCAGTCAG104895/6055/3060/30
AhyaD-hyaCTGTTGCCATCATTGTCAGTG
Tox ACTTAGATGAGCGACAAGG84694/3055/3072/30
Tox AGAATGCCACACCTCTATAG
Fim 4 (ptfA)TGTGGAATTCAGCATTTTAGTGTGTC48894/3055/3072/60
Fim 4TCATGAATTCTTATGCGCAAAATCCTGCTGG
Nan bAGTGTCCGGGAATAGTGGTG55594/3058/3072/60
Nan bCCGTTGTTCACAACGAACC
Nan hGAATATTTGGGCGGCAACA28794/3056/3072/30
Nan hTTCTCGCCCTGTCATCACT
OmphCGCGTATGAAGGTTTAGGT43894/3057/3072/60
OmphTTTAGATTGTGCGTAGTCAAC

La mezcla de PCR se realizó en un volumen final de 25 μL y se empleó 12,5 μL Go Taq Green Master Mix 2X (Promega), 0,8 μM de cada cebador y 5 μL de ADN. Los ensayos se realizaron en un termociclador (Mastercycler). La visualización de los productos de PCR se realizó en geles de agarosa (2 % en TBE 0.5x) teñidos con Bromuro de Etidium (0,5 mg/mL), en un transiluminador de luz ultravioleta (Pharmacia LKB). Se utilizó un marcador de peso molecular de 1Kb (Promega), agua libre de nucleasa como control negativo y ADN de una cepa de P. multocida aislada de cerdo que forma parte de la colección del laboratorio de Bacteriología Animal del Centro Nacional de Sanidad Agropecuaria (CENSA), Cuba.

Para determinar la expresión fenotípica de material capsular en las cepas correspondientes a los tipos capsular A o D, más comúnmente reportados para conejos (27), se realizaron los métodos descritos por Carter y Subpronto (27). Las cepas se sembraron en 3 mL de Caldo Infusión Cerebro Corazón (BHI), durante 24 horas. Posteriormente, el cultivo se centrifugó durante 10 minutos a 1500 g, se eliminaron 2,5 mL del sobrenadante y se adicionó al medio 0,5 mL de la solución de Acriflavina (solución acuosa de acriflavina (Sigma) en una proporción 1:1000). Después de cinco minutos, se consideró positiva (adscripción al tipo capsular D) la reacción ante la aparición de un precipitado floculento en el medio de cultivo.

La detección del tipo capsular A se realizó mediante una modificación del procedimiento no serológico descrito por Rutter (28); de esta forma, las cepas fueron detectadas por la sensibilidad a la hialuronidasa. Las cepas se cultivaron en agar sangre durante 24 horas; se preparó una suspensión de turbidez equivalente a 4, según la escala de McFarland, y se diluyó la muestra 1:5 en agua destilada. Se sembró cada cepa en masa sobre agar BHI (Merck); luego, se depositó en el centro de cada placa un disco de papel de filtro estéril, impregnado con una solución de hialuronidasa (Sigma), de 5600 unidades por mL, a razón de 10 μL por disco. Se incubaron las placas a 37ºC durante 24 horas. La reacción positiva se manifiesta por la reducción en el tamaño de las colonias de P. multocida alrededor del disco.

Se determinó la susceptibilidad antimicrobiana ante un panel de 12 antibióticos, mediante el método de difusión en disco (29). De cada cepa se preparó una suspensión en solución salina hasta lograr una turbidez similar a la del tubo 0,5 de la Escala de McFarland correspondiente a 1,5x108UFC/mL. La siembra se realizó hisopando la superficie del Agar Muller Hilton (MH). Se utilizaron los siguientes antibióticos: (Liofilchem, Italia):cloranfenicol (30 µg), gentamicina (10 µg), kanamicina (30 µg), tetraciclina (30 µg), ciprofloxacina (5 µg), penicilina (10 IU), eritromicina (15 µg), ceftriazona (30 µg), streptomicina (10 µg), sulfametoxazol (50 µg), amoxicillin (30 µg) y carbenicilina (100 µg). Luego de un periodo de predifusión de los antibióticos a temperatura ambiente durante 45-60 min, las placas de agar MH se incubaron a 37ºC durante 16 horas (31). Una vez transcurrida la incubación se midió el diámetro del halo de inhibición del crecimiento bacteriano y los datos registrados se interpretaron según las tablas de valores de corte epidemiológicos para P. multocida de Eucast (30).

Se siguió el protocolo propuesto por Christensen (31), con las siguientes modificaciones: se partió de cultivos en placas de Agar Columbia suplementado con 5 % de sangre de cordero y se seleccionaron, aproximadamente, cinco colonias que se inocularon en tubos con 5 mL de medio Caldo Triptona Soya (Biocen), suplementado con suero fetal bovino al 5 % y se incubaron a 37ºC durante 24 horas; seguidamente, se transfirió un volumen de 100 µL de estos cultivos en triplicado a placas de microtitulación de 96 pocillos (Greiner) y se incubaron de forma estática a 37ºC durante 24 horas. Posteriormente, el medio de cultivo se removió y las placas se lavaron con 150 µL de agua destilada y se secaron a 60ºC durante 30 min en el horno. A continuación, se realizó la tinción de los pocillos con 130 µL de Cristal Violeta (Sigma) al 1 % por 5 min y se retiró el colorante. Se lavaron los pocillos cuatro veces con 150 μL de agua destilada y se secaron una hora a temperatura ambiente. A continuación, se añadió 130 µL de ácido acético 33 % y se midió la densidad óptica a la longitud de onda 492 nm en lector de placas (SUMA, PR-621, Cuba). Como control negativo se utilizaron pocillos con medio líquido no inoculados. La clasificación de las cepas de P. multocida, atendiendo a su capacidad de formación de biopelícula, se basó en los valores de densidad óptica a 492 nm propuestos por Christensen et al. (31).

Todas los aislados fueron positivos a la presencia de las enzimas oxidasa y catalasa, no evidenciaron crecimiento en Agar Mac Conkey y la identificación, según el Sistema Api, coincidió con P. multocida. Una vez confirmado cada aislado por pruebas fenotípicas como cepas correspondientes a la especie P. multocida, se procedió a su caracterización en cuanto a la composición en biovares. Las cepas revelaron liberación de Indol a partir del triptófano por acción de la enzima triptofanasa, así como descarboxilación de la ornitina, lo cual coincide con Mutter et al. (32), quienes sugirieron que la capacidad de descarboxilación de la ornitina es útil para diferenciar a esta bacteria del resto de las especies del género Pasteurella. Las cepas no fueron capaces de utilizar la urea, lo que evidencia la ausencia de la enzima ureasa; tampoco utilizaron el citrato como única fuente de carbono (Tabla 2). Estos resultados coinciden con lo descrito en cuanto al comportamiento frente a estas pruebas bioquímicas para P. multocida (33,34).

Tabla 2. 

Características bioquímicas de las cepas de Pasteurella multocida./ Biochemical characteristics of Pasteurella multocida strains.

Pruebas bioquímicasCepas (PmCcp)
C1C2C3C4C5C11C6C7C8C9C10
Oxidasa+++++++++++
Catalasa+++++++++++
Glucosa---V+-------
NO3+++++++++++
Indol+++++++++++
Urea-----------
Citrato-----------
ODC+++++++++++
Asimilación de la Xylosa--+--------
Asimilación del Manitol++++-++++++
Asimilación de la Sacarosa, Sorbitol+++++++++++
Asimilación de otros azúcares (Lac, Ino, Rha, Mel, Ara, Dulc)-----------
Identificación (Api)Pasteurella multocida 93,1 %

Con relación a la asimilación del Sorbitol, todas las cepas mostraron reacción positiva, mientras que para el Manitol solo 91 % (Tabla 3); estos resultados son similares a los obtenidos por Benzaquén (35), quien encontró que solo 39,5 % de las cepas evaluadas asimiló la Glucosa, 63,6 % utilizó Sorbitol y 2,5 % Manitol.

Las tres subespecies (multocida, septica y gallicida) de P. multocida spp. se distinguen, fenotípicamente, en diferentes patrones acorde a la utilización de sorbitol y dulcitol; estas tres subespecies, a su vez, se agrupan en 13 biovares (1-10 y 12-14) mediante el patrón bioquímico derivado de estas pruebas. La subespecie multocida comprende actualmente los biovares 1, 2, 3, 4, 9, 12, 13 y 14; la subespecie septica 5, 6, 7 y 10 y la subespecie gallicida únicamente el biovar 8 (35). En esta colección todas las cepas pertenecieron a la subespecie multocida, 10 correspondieron al biovar 1 y solo una al biovar 3 (Tabla 3).

Son escasos los trabajos publicados en los que se realizó una caracterización fenotípica de las cepas de P. multocida y su clasificación en diferentes biovares. Los primeros estudios de biotipado en P. multocida se realizaron con aislados procedentes de aves en Australia, donde se detallaron 14 biovares diferentes (36). Existen escasos reportes sobre los biovares de P. multocida que colonizan o infectan al conejo. Virag (37) encontró que los biovares de P. multocida que más prevalecieron fueron el 6, 1, 3 y 9 en conejos enfermos con signos respiratorios.

Tabla 3. 

Biovares de las cepas de Pasteurella multocida aisladas./ Biovars of isolated Pasteurella multocida strains.

CEPASProducción deUtilización de :Subespecie de P.multocida /biovar
UreasaODCArabinosaDulcitolMaltosaSorbitolTrehalosaXylosaLactosa
1-+---+---multocida / 1
2-+---+---multocida/ 1
3-+---+-+-multocida/ 3
4-+---+---multocida/ 1
5-+---+---multocida/ 1
6-+---+---multocida/ 1
7-+---+---multocida/ 1
8-+---+---multocida/ 1
9-+---+---multocida/ 1
10-+---+---multocida/ 1
11-+---+---multocida/ 1

Las diferencias halladas en las cepas, en cuanto a las pruebas bioquímicas, evidencian la heterogeneidad en el comportamiento de las mismas, aun cuando corresponden a una especie; sin embargo, varían en cuanto a la expresión de algunas de sus enzimas o en la capacidad de asimilación de algunos nutrientes y esto podría estar relacionado también con la expresión de algunos de sus factores de virulencia. Las cepas pertenecientes al biovar 1 se recobraron de ambos grupos de animales, con neumonía y aparentemente sanos; la cepa correspondiente al biovar 3 se aisló de un animal con pasteurelosis sistémica. Los aislados procedentes de pasteurelosis sistémica en cerdos obtenidos por Benzaquén (35) también se clasificaron en el biovar 3.

Las características fenotípicas y su definición como cepas correspondientes a la especie P. multocida se corroboraron mediante PCR por la amplificación de un fragmento de 460 pb específico para esta especie (5). La familia Pasteurellaceae ha sufrido numerosas reclasificaciones durante los últimos años por el empleo de técnicas polifásicas basadas en caracteres fenotípicos y genotípicos. Actualmente contiene 25 géneros, entre los que se encuentran: Actinobacillus, Aggregatibacter, Avibacterium, Basfia, Bibersteinia, Bisgaardia, Chelonobacter, Cricetibacter, Frederiksenia, Gallibacterium, Haemophilus, Histophilus, Lonepinella (38); estos comparten características comunes en las pruebas fenotípicas, como pueden ser los sistemas Api que se emplearon en este trabajo. El esclarecimiento de las cercanías genotípicas entre miembros de esta familia revela la necesidad del empleo de marcadores conservados y específicos de cada especie para su confirmación como tal, de ahí la necesidad de utilizar ensayos genotípicos para la discriminación y confirmación.

En la Figura 1 se muestra el producto de amplificación correspondiente a una región de 1048 pb que se localiza en el locus para la biogénesis del tipo capsular A. Todas las cepas, fueron positivas, por lo que correspondieron al serotipo capsular A.

2224-4700-rsa-41-01-e02-gf1.jpg

Figura 1. 

Electroforesis de los productos de PCR en gel de agarosa al 2 %. PCR del gen cap A en cepas de Pasteurella multocida.1: control negativo (agua libre de nucleasas); 2: marcador de epso molecular de (1Kb); 3: cepa 1; 4: cepa 2; 5: cepa 3; 6: cepa 4; 7: cepa 5; 8: cepa 6; 9: cepa 7; 10: cepa 8; 11: cepa 9; 12: cepa 10./ Electrophoresis of the PCR products in 2 % agarose gel. PCR of the cap A gene in Pasteurella multocida strains. 1: negative control (nuclease-free water); 2: molecular weight (1Kb); 3: strain 1; 4: strain 2; 5: strain 3; 6: strain 4; 7: strain 5; 8: strain 6; 9: strain 7; 10: strain 8; 11: strain 9; 12: strain 10.

La clasificación de los serogrupos capsulares de P. multocida es esencial para los estudios de patogenicidad y epidemiológicos relacionados con esta especie. Las bases biológicas de este fenómeno no son totalmente conocidas, pero sí sugieren que la cápsula está relacionada con la patogénesis y con la predilección por un hospedero (38).

La detección por PCR de un fragmento del gen, que forma parte del locus para la biogénesis del tipo capsular A, predice la potencialidad de estas cepas de pertenecer a este serogrupo. La prueba fenotípica reveló positividad a la presencia de la enzima hialuronidasa y mostró una reacción negativa a la prueba de la acriflavina, confirmando que las cepas poseen la cápsula tipo A; lo anterior coincide con otros investigadores, quienes plantean que el tipo capsular A es más común en conejos (1,27,28).

La existencia de cepas pertenecientes solo al tipo capsular A sugiere que podría ser el único serotipo capsular que se encuentre circulando en el área de estudio, lo que puede suponer que parten de una cepa original, la cual perdura en el tiempo y ocasiona diferentes brotes. Es posible que estas cepas permanezcan de forma latente en su hospedero natural o en el ambiente que conforma el entorno de los animales y ante cualquier estrés desencadenan brotes respiratorios.

No hubo cepas que amplificaran el gen de la toxina dermonecrótica (tox A); hasta la fecha se ha descrito la presencia de este gen para cepas correspondientes al tipo capsular D y específicamente relacionadas con la rinitis atrófica del cerdo (39). Todas las cepas fueron positivas para los genes que participan en la biogénesis de fimbrias y neuroaminidasa del tipo NanH. La colonización de los tejidos del hospedero por las bacterias Gram negativas se facilita por varios tipos de adhesinas, una de ellas es la fimbria tipo 4, que en P. multocida es codificada por el gen ptfA y constituye un factor importante en la adhesión a células del epitelio del tracto respiratorio superior (40).

Las sialidasas (NanH y NanB) también se reconocen como importantes factores de virulencia, pues enmascaran factores del hospedero; 100 % de las cepas evaluadas fueron positivas a la presencia del marcador NanH, no así para NanB, donde solo a partir del 50 % de las cepas fue posible la amplificación de un fragmento específico para este marcador; estas sialidasas se encuentran ampliamente distribuidas en todos los serotipos capsulares (26).

El 100 % de las cepas evaluadas también fueron positivas al gen ompH que codifica para una proteína de membrana externa de 37,5 kDa, muy similar a las porinas de otras bacterias Gram negativas; se plantea que su función en P. multocida está asociada a la virulencia y facilita la interacción con el sistema inmune del hospedero (41).

Estudios previos realizados en cepas procedentes de diferentes hospederos en cerdos y aves han demostrado que la mayoría de las cepas de esas colecciones fueron positivas a estos marcadores, aunque también se han encontraron cepas que fueron negativas para los genes ompH, ptf y sialidasas (42). Es posible la ausencia de estos marcadores o que las regiones donde hibridan los cebadores hayan sufrido mutaciones que impidan su reconocimiento por estos; aspectos que requieren un estudio más profundo mediante la secuenciación de genoma completo en cepas que permanezcan negativas a estos genes, así como su correlación con datos de patogenicidad para comprobar la relación de estos marcadores con la virulencia de las mismas.

Algunas cepas de P. multocida pueden formar parte de la microbiota del tracto respiratorio; sin embargo, la presencia en ella de factores de virulencia favorecen la presentación de signos clínicos, incluso, infecciones graves que provocan alta mortalidad. Esto tiene lugar bajo ciertas condiciones ambientales o de manejo, como son la transportación, la ventilación y la alimentación, que inducen estrés en los animales, así como por la presencia de las cepas de virus o Mycoplasma spp. en el tracto respiratorio, que provocan daño a la membrana de las mucosas del hospedero y favorecen la proliferación de otros patógenos con factores para la virulencia, como las cepas de P. multocida (38) caracterizadas en este estudio.

Todas las cepas mostraron un patrón de resistencia elevado:100 % fueron resistentes a kanamicina, amoxicilina, ceftriazona, carbenicilina, eritromicina, sulfametoxazol y estreptomicina; 90,9 % resultó resistente a tetraciclina, ciprofloxacina y penicilina; 81,8 % a cloranfenicol y 72,7 % a gentamicina. Los hallazgos de cepas multirresistentes de P. multocida a estas familias de fármacos se notifican con frecuencia desde hace algunos años; sin embargo, la mayoría de los datos es de cepas de origen porcino, aviar, bovino y, en menor medida, procedentes de gatos y perros (38); en conejos existen muy pocos datos.

Durante la última década, el alto grado de resistencia a los antibióticos comunes y la emergencia mundial de los fenotipos resistentes a multidrogas tienden a convertirse en una preocupación creciente; el uso no prudente de los antimicrobianos favorece la selección de bacterias resistentes y promueve la aparición de mutaciones en genes de resistencia localizados en plásmidos, integrones y transposones, lo que ha producido una reducción en la eficacia de los antimicrobianos que están actualmente disponibles para el tratamiento de infecciones en los animales y, a su vez, en la salud pública (43).

Las cepas que mostraron resistencia se aislaron tanto de animales con sintomatología respiratoria como de los aparentemente sanos. Estas bacterias no solo constituyen un riesgo para el hospedero en que se encuentran, sino también para el resto de los animales que lo rodean y para el personal que labora con ellos, dada su fácil transmisión por vía aerógena y su difícil erradicación (11). La actualización de las bases moleculares, que soportan la resistencia en miembros de la familia Pasteurellace, revela que estos elementos son intercambiables horizontalmente entre especies de esta familia, así como con otros géneros Gram negativos; de ahí la necesidad de un continuo monitoreo para un uso adecuado de los antibióticos con probabilidades de eficacia y reducir el impacto de la coselección de genes de resistencia (38).

En cuanto a la formación de biopelículas, solo dos cepas (7 y 8) fueron moderadas formadoras de biopelículas, mientras que el resto no mostró esta propiedad. Ambas fueron aisladas de animales aparentemente sanos, lo que podría estar relacionado con infecciones de tipo crónicas, en las cuales la capacidad de producción de biopelículas permite que las cepas persistan en el hospedero o el ambiente que lo rodea por largos periodos de tiempo y le confiere a la infección un carácter recidivante.

Las biopelículas en un hospedero constituyen una compleja mezcla de bacterias, células del hospedero, exopolisacáridos, ácidos nucleicos extracelulares, nutrientes atrapados en agua y proteínas. Estas comunidades se comparan con tejidos que forman las células eucariotas; en las biopelículas, las células revelan cooperación, se protegen de condiciones desfavorables en el ambiente externo y aseguran su persistencia (44).

Aunque P. multocida no se considera un fuerte formador de biopelículas in vitro (45), existen algunos informes contradictorios para cepas aisladas de diferentes hospederos, que muestran un incremento de la adherencia por el empleo de otras superficies como las perlas de bentonita (46). Parece que la naturaleza química de los polisacáridos capsulares que forman las cepas del serotipo A interfiere, fundamentalmente, en el contacto de las células con las superficies. La cantidad de polisacárido capsular es inversamente proporcional a la cantidad de biopelícula formada, pues las cepas que pierden o reducen la capacidad de formar cápsulas resultan fuertes formadores de biopelículas (45).

La capacidad de formar biopelículas no es necesaria para la virulencia, pero contribuye a la colonización a largo plazo, a la transmisión y al incremento de las dificultades para erradicar estas infecciones (44,46). En este trabajo, en las condiciones in vitro evaluadas, no se mostró una fuerte producción de biopelículas en las cepas estudiadas; sería conveniente valorar otras condiciones que simulen aún más el entorno in vivo, como podría ser la adición de plasma o fibrinógeno.

El 90 % de las cepas de P. multocida pertenecieron al biovar 1 y solamente una cepa correspondió al biovar 3; todas pertenecen a la subespecie multocida. Todas las cepas mostraron gran similitud, tanto bioquímica como genotípica, fundamentalmente en cuanto a los factores de virulencia, lo que constituye una contribución a la caracterización de cepas que podrían ser consideradas en la obtención de candidatos vacunales o sueros terapéuticos para la prevención o profilaxis de infecciones por esta bacteria.

 

REFERENCIAS

1. Youssef EA. Study of pathogenicity and immunogenicity of Pasteurella multocida recently isolated from infected rabbits. Egypt J Agric Res. 2011;9:2.

2. Kawamoto E, Sawada T, Maruyama T. Prevalence and characterization of Pasteurella multocida in rabbits and their environment in Japan. Nippon Juigaku Zasshi. 1990;52:915-921.

3. Stahel AB, Hoop RK, Kuhnert P, Korczak BM. Phenotypic and genetic characterization of Pasteurella multocida and related isolates from rabbits in Switzerland. J Vet Diag Invest. 2009;21(6):793-892.

4. Brenda A, Mengfei Ho. Pasteurella multocida: from Zoonosis to Cellular Microbiology. Clin Microbiol Rev. 2013;26(3):631-655.

5. Townsend KM, Boyce JD, Chung JY, Frost AJ, Adler B. Genetic Organization of Pasteurella multocida cap Loci and Development of a Multiplex Capsular PCR Typing System. J Clin Microbiol. 2001;39:3924-929.

6. Thales QF, Apellanis K, Laviniki V, Da Silveira RSL, Neves de Almeida C. Virulence genes and antimicrobial resistance of Pasteurella multocida isolated from poultry andswine. Braz J Microbiol. 2016;7:210-216.

7. Jabben A, Khattak M, Munir S, Jamal Q, Hussain M. Antibiotic Susceptibility and Molecular Analysis of Bacterial Pathogen Pasteurella multocida isolated from cattle. J Appl Pharmaceutical Sci. 2013;3:106-110.

8. Shivachandra SB, Viswas KN, Kumar A. A review of haemorrhagic septicaemia in catte and buffalo. Anim Health Res. 2011;12:67-82.

9. Qureshi S, Saxena HM. Estimation of titer of antibody against Pasteurella multocida in cattle vaccinated with haemorrhagic septicemia alum precipitated vaccine. Vet World. 2014;7(4):224-228.

10. Bethe A, Wieler LH, Selbitz HJ, Ewers C. Genetic diversity of porcine Pasteurella multocida strains from the respiratory tract of healthy and diseased swine. Vet Microbiol. 2009;139(1-2):97-105.

11. Ferreira TS, Felizardo MR, de Gobbi DD, Moreno M, Moreno AM. Antimicrobial resistance and virulence gene profiles in P. multocida strains isolated from cats. Braz J Microbiol. 2015;46(1):271-277.

12. Gallego C, Romero S, Esquinas P, Patiño P, Martínez N, Iregui C.Assessment of Pasteurella multocida A Lipopolysaccharide, as an Adhesin in an In Vitro Model of Rabbit Respiratory Epithelium. Vet Med Int. 2017;13:8967618.

13. Deeb B, DiGiacomo R. Respiratory diseases of rabbits. Res Med. 2000;3:465-480.

14. Patrick JM. Naturally Occurring Pasteurellosis in Laboratory Rabbits: Chemical and Serological Studies of Whole Cells and Lipopolysaccharides of Pasteurella multocida. Infect. Inmun. 1984;44(2):502-507.

15. Jaglic Z, Jeklova E, Leva L, Kummer V, Kucerova Z, Faldyna M, et al. Experimental study of pathogenicity of Pasteurella multocida serogroup F in rabbits. Vet Microbiol. 2008;126:168-177.

16. Ewers C, Lubke B, Bethe A, Kiebling S, Filter M, Wiler LH. Virulence genotype of Pasteurella multocida strains isolated from different hosts with various disease status. Vet Microbiol. 2006;8:304-317.

17. Harper M, Boyce J, Adler B. Pasteurella multocida pathogenesis: 125 years after Pasteur. FEMS Microbiology Letters. 2006;265:11-10.

18. Hunt ML, Adler B, Townsend KM. The Molecular Biology of Pasteurella multocida. Vet Microb. 2000;72:3-25.

19. Fernández-Rojas MA, Vaca S, Reyes-López M, De la Garza M, Aguilar-Romero F, Zenteno E, et al. Outer membrane vesicles of Pasteurella multocida contain virulence factors. Microbiol Open. 2014;3(5):711-717.

20. Nhung NT, Chansiripornchai N, Carrique-Mas JJ. Antimicrobial Resistance in Bacterial Poultry Pathogens: A Review. Front. Vet Sci. 2017;4:126.

21. Ruffolo CG, Tennent JM, Michalski WP, Adler B. Identification, purification, and characterization of the type 4 fimbriae of Pasteurella multocida. Infect Immun. 1997;65:339-343.

22. Sánchez S, Mizan S, Quist C, Schroder P, Juneau M, Dawe D, et al. Serological Response to Pasteurella multocida NanH Sialidase in Persistently Colonized Rabbits. Clin Diag Lab Immunol. 2004;11(5):825-834.

23. Hoelzer K, Bielke L, Blake DP, Cox E, Cutting SM, Devriendt B, et al. Vaccines as alternatives to antibiotics for food producing animals. Part 2: new approaches and potential solutions. Vet Res. 2018;49:70.

24. Leotta G, Vigo G, Chinen I, Prieto M, Callejo R, Rivas M. Identificación, biotipificación y caracterización de cepas de Pasteurella multocida aisladas en la Argentina. Rev Argent Microbiol. 2006; 38;3:1851-57.

25. Jaglic Z, Jeklova E, Leva L, Kummer V, Kucerova Z, Faldyna M, et al. Experimental study of pathogenicity of Pasteurella multocida serogroup F in rabbits. Vet Microbiol. 2008;126,168-177.

26. Ewers C, Lubke B, Bethe A, Kiebling S, Filter M, Wiler LH. Virulence genotipe of Pasteurella multocida strains isolated from different hosts with various disease status. Vet Microbiol. 2006;8:304-317.

27. Carter GR, Subpronto P. Identification of type D strains of Pasteurella multocida with acriflavine. American J Vet Res. 1973;34:293-294.

28. Rutter JM. Virulence of Pasteurella multocida in athrophic rhinitis of gnotobiotic pigs infected with Bordetella bronchiseptica. Res Vet Sci. 1983;34:285-287.

29. Clinical Laboratory Standards. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals; Approved Standard, 2nd Edn. NCCLS Document M31-A3. Wayne, PA:2008; National Committee for Clinical Laboratory Standards

30. EUCAST. Clinical Breakpoints Table v. 5.0. Available: http://www.eucast.org/clinical_breakpoints/

31. Christensen GD, Simpson WA, Younger JA, Baddour LM, Barrett FF, Melton DM, et al. Adherence of cogulase negative Staphylococi to plastic tissue cultures: a quantitative model for the adherence of staphylococci to medical devices. J Clin Microbiol. 1985;22:996-1006.

32. Mutters R, Bisgaard M, Pohl S. Taxonomic relationship of selected biogroups of Pasteurella haemolytica as revealed by DNA: DNA hybridizations. Acta Pathol Microbiol Immunol Scand. 1986;94:195-202

33. Fegan N, Blackall P, Pahoff J. Phenotypic characterization of Pasteurella multocida isolates from Australian poultry. Vet Microbiol. 1995;47:281-286.

34. Blackall P, Pahoff J, Bowles R. Phenotypic characterization of Pasteurella multocida isolates from Australian pigs. Vet Microbiol. 1997;57:355-360.

35. Benzaquén NG, Fernández-Garayzábal J, Goyache JG, Vela AIA. Caracterización fenotípica y genética de aislados de Pasteurella multocida obtenidos de ganado porcino. (Tesis Doctoral(, Madrid, España. ISBN: 978-84-693-2407-3. 2010.

36. Ekundayo SO, Odugbo MO, Olabode AO, Okewole PA. Phenotypic variability among strains of Pasteurella multocidaisolated from avian, bovine, caprine, leporine and ovine origin. African J Biotech. 2008;7(9):1347-1350.

37. Virag GY, Barna T, Fabian K, Frasang K. Pheno- and genotypic characterization of Pasteurella multocida strains recovered from healthy and diseased rabbits. Pathology and Hygiene. 2008;113-117.

38. Michael GB, Bossé JT, Schwarz S. Antimicrobial resistance in Pasteurellaceae of veterinary origin. Microbiol Spectr. 2018;6(3).

39. Tang X, Zhao Z, Wu B, Cai X, He Q, Chen H. Isolation, antimicrobial resistance and virulence genes of Pasteurella multocida strains from swine in China. J Clin Microbiol. 2009;47(4):51-958.

40. Doughty SW, Ruffolo CG, Adler B. The type4 fimbrial subunit gene of Pasteurella multocida. Vet Microbiol. 2000;72:79-90.

41. Chevalier G, Duclohier H, Thomas D, Shechter E, Wroblewski H. Purification and characterization of protein H, the major porin of Pasteurella multocida. J Bacteriol. 1993;175:266-276.

42. Furian TQ, Borges KA, Laviniki V, Rocha SL, de Almeida CN, do Nascimento VP, et al. Virulence genes and antimicrobial resistance of Pasteurella multocid aisolated from poultry and swine. Braz J Microbiol. 2016;47(1):210-216.

43. Sharma C, Rokana N, Chandra M, Singh BP, Gulhane RD, Gill JPS, et al. Antimicrobial Resistance: Its Surveillance, Impact, and Alternative Management Strategies in Dairy. Animals Front Vet. Sci. 2018;4:237.

44. Basson A, Flemming LA, Chenia HY. Evaluation of adherence, hydrophobicity, aggregation characteristics and biofilm development of Flavobacterium johnsonia e-like isolates from South African aquaculture systems. Microb Ecol. 2008;55:1-14.

45. Petruzzi B, Briggs RE, Swords WE, DeCastro C, Molinaro A, Inzana TJ. Capsular polysaccharide interferes with biofilm formation by Pasteurella multocida serogroup A. mBio. 2017;8:01843-17.

46. Ramachandranpillai R, Govindapillai KN, Mangattumuruppel M, Leo J, Mapranath RS, Koshy J. Bioflm formation of Pasteurella multocidaon bentonite clay. Iran J Microbiol. 2013;5(2):120-125.

 

 

 

 


Los autores de este trabajo declaran no presentar conflicto de intereses.

Este artículo se encuentra bajo licencia Creative Commons Reconocimiento-NoComercial 4.0 Internacional (CC BY-NC 4.0)  


Enlaces refback

  • No hay ningún enlace refback.