Articulo Original

https://eqrcode.co/a/Vl6O3s

Desarrollo de PCR especie-específicos para la detección de micoplasmas contaminantes de cultivos celulares

Development of species-specific PCRs for the detection of mycoplasmas cell culture contaminants


RESUMEN

La contaminación por Mollicutes en los cultivos celulares es frecuente. Especies como Mycoplasma arginini, Mycoplasma salivarium, Mycoplasma fermentans, Mycoplasma hyorhinis, Mycoplasma orale y Acholeplasma laidlawii se identifican como causantes del 95 % de las contaminaciones. El presente trabajo tuvo como objetivo desarrollar PCR especie-específicos para la identificación de las especies de micoplasmas contaminantes más frecuentes en cultivos celulares. Se optimizaron los parámetros críticos de la PCR y se determinaron la sensibilidad y especificidad analítica. Se estableció como valor óptimo de temperatura de hibridación 55ºC; concentración de magnesio 1,5 mM y de cebadores se seleccionó un rango 0,3-0,5 µM. La sensibilidad analítica de la PCR fue de 1 pg/µL, mientras que su especificidad analítica fue 100 %. Se realizó la PCR especie-específico a 58 muestras de cultivo celulares donde previamente se detectó la presencia de Mollicutes. Como resultado se detectó Mycoplasma orale como la especie más frecuente, seguida de Mycoplasma fermentans, Acholeplasma laidlawii, Mycoplasma arginini, Mycoplasma hyorhinis y Mycoplasma salivarium. Los resultados de este estudio confirman que los ensayos PCR especie-específicos desarrollados son factibles de emplear para la identificación de especies de micoplasmas en cultivos celulares.

Palabras clave: 

cultivos celulares; diagnóstico; micoplasmas; PCR.

ABSTRACT

Mollicute contamination in cell cultures is common. Species such as Mycoplasma arginini, Mycoplasma salivarium, Mycoplasma fermentans, Mycoplasma hyorhinis, Mycoplasma orale, and Acholeplasma laidlawii are identified as causing 95 % of the contaminations. The present work is aimed at developing species-specific PCRs for the identification of the most frequent contaminating mycoplasma species in cell cultures. The critical parameters of PCR were optimized and the analytical sensitivity and specificity were determined. The optimum temperature for hybridization was set at 55ºC; magnesium concentration at 1,5 mM. A range of 0,3-0,5 µM was selected for the primers. The analytical sensitivity of PCR was 1 pg/µL, while its analytical specificity was 100 %. Species-specific PCR was performed on 58 cell culture samples where the presence of Mollicutes was previously detected. As a result, Mycoplasma orale was detected as the most frequent species, followed by Mycoplasma fermentans, Acholeplasma laidlawii, Mycoplasma arginini, Mycoplasma hyorhinis, and Mycoplasma salivarium. The results of this study confirm that the species-specific PCR assays developed are feasible to use for the identification of mycoplasma species in cell cultures.

Key words: 

cell culture; diagnosis; mycoplasmas; PCR.


El cultivo celular juega un papel importante en la biotecnología moderna y en el desarrollo de numerosos proyectos de investigación (1). La contaminación de estos cultivos por hongos y bacterias es frecuente y tratable; sin embargo, se produce una contaminación grave y no fácilmente detectable por micoplasmas (2).

Estos microorganismos se aislaron por primera vez de un cultivo celular en 1956 por Robinson y Wichelhausen (3). Desde entonces y hasta la fecha, alrededor de 20 especies se describen como contaminantes en los cultivos celulares, donde Mycoplasma arginini, Mycoplasma salivarium, Mycoplasma fermentans, Mycoplasma hyorhinis, Mycoplasma orale y Acholeplasma laidlawii se identifican como causantes del 95 % de las contaminaciones (4). La incidencia de contaminación a nivel mundial de los cultivos celulares para una especie se encuentra entre 15 y 80 %; mientras que la coinfección puede encontrarse hasta en 60 % (5).

Se conoce que las especies Mycoplasma orale, Mycoplasma fermentans y Mycoplasma hominis se hallan comúnmente en el tracto orofaríngeo de los humanos, lo cual supone que el personal de laboratorio constituye una de las fuentes de contaminación de los cultivos celulares con micoplasmas (6). Por otra parte, Mycoplasma arginini y Acholeplasma laidlawi son frecuentemente identificadas en el suero bovino y Mycoplasma hyorhinis es un patógeno frecuente de cerdos, de ahí que, tanto el suero bovino como el porcino que se utilizan para la elaboración de los medios de cultivo, pueden ser también una fuente posible de contaminación (7).

Otras fuentes de contaminación se relacionan con los animales de laboratorio (8), con embriones de pollos (9) y con los tejidos que se utilizan para la elaboración de cultivos primarios; de igual manera, las líneas celulares ya contaminadas pueden propagar la contaminación de micoplasmas (10).

Dada la importancia de la detección de las especies de micoplasmas más frecuentes en los cultivos celulares y la posibilidad de identificar la probable fuente de contaminación, el estudio tuvo como objetivo desarrollar ensayos PCR especie-específicos para la identificación de las especies más frecuentes de micoplasmas en cultivos celulares.

Se emplearon cepas de referencia pertenecientes a la Colección de Cultivos tipo Americana (ATCC, de sus siglas en inglés American Type Culture Collection) de Mycoplasma orale (ATCC15544), Mycoplasma fermentans (ATCC 19989), Mycoplasma salivarium (ATCC 23064) y de la Colección Nacional de Cultivos tipo Inglaterra (NCTC del inglés National Collection Type Culture) Mycoplasma arginini (NCTC 10129), Mycoplasma hyorhinis (NCTC 10130) y de la Farmacopea Europea (Ph. Eur., de sus siglas en inglés European Pharmacopoiea) Acholeplasma laidlawii, pertenecientes todas a la colección de cepas del laboratorio MYCOLAB, CENSA, Cuba.

El cultivo de las cepas se realizó según lo descrito por Poveda (10). Se incubó durante 15 días en condición demicroarofilia y se realizaron lecturas cada 48 horas en el microscopio óptico marca Epson.

De cada cultivo positivo a micoplasmas se tomó 1mL y se transfirió estérilmente a un tubo (Eppendorf de 1,5mL; se centrifugó a 12 000 rpm por 10 min; el sobrenadante se desechó y el sedimento se resuspendió en 1mL de tampón fosfato salino (PBS) estéril y se homogenizó con agitación durante 2 minutos; luego, se repitió la centrifugación. Nuevamente el sobrenadante se desechó y el sedimento se resuspendió en 0,1 mL de agua destilada estéril. Se homogenizó durante 1 minuto y se colocó la suspensión en bloque térmico (Labnet, E.U.A.) a 100ºC durante 10 minutos e inmediatamente se colocó en un recipiente con hielo. Cada vial se conservó a -20ºC hasta posterior utilización, según lo descrito por Hernández et al. (11). La calidad y concentración del ADN se determinaron en el equipo ThermoScientific Nanodrop 2000 Spectrophotometer.

Los cebadores utilizados (Tabla 1) amplifican una región correspondiente al ARNr 16S de cada una de las especies de micoplasmas a diagnosticar mediante los ensayos de PCR especie-específicos.

Tabla 1. 

Secuencia nucleotídica de los cebadores utilizada para la amplificación del ADN de micoplasmas./ Nucleotide sequence of primers used for mycoplasma DNA amplification.

EspecieSecuencia nucleotídica (5´-3´)Talla del fragmento (pb)Referencia
M. argininiS: TGA TCA TTA GTC GCT GGA GAG TC326Kazemiha et al.(12).
AS: TAT CTC TAG AGT GCT CGA CA TGA CTC
M. oraleS: TGA TCA TTA GTC GGT GGA AAA CTA325
AS: TAT CTC TAG AGT CCT CGA CA TGA CTC
M. fermentansS: TGA TCA TTA GCT GAT GGG GAA CT324
AS: TCT CTT AGA GTC CTC AAC TAA ATG
Acholeplasma laidlawiiS GAT GAG AAC TAA GTG TTG GCC ATA A300
AS: CGC TAG AGT CCC CAA CTT AAT GA
M. salivariumS: ATGGATTGTAAAGTGCTGTTGCTAG434Timenetsky et al. (19).
AS: GCGTCAACAGTTCTCTGCCG
M. hyorhinisS: GTA GTC AAG CAA GAG GAT GT346Assunçâo et al. (18).
AS: GCT GGA GTT ATT ATA CCA GGA

Leyenda: S: sentido; AS: antisentido

Para lograr la identificación de las especies de micoplasmas más frecuentes se realizó la amplificación a partir del ADN extraído del cultivo de cada una de las cepas descritas con anterioridad. La reacción se llevó a cabo en un volumen final de 25 μL, que contenía1X solución tapón II (Promega), 200 µM de cada dNTPs (Promega); 15 pmoles de cada cebador, 1,5 mM de MgCl2 (Promega), 1 U de Taq polimerasa (Promega) y 3 µL de muestra de ADN de cepa de referencia. Se empleó agua libre de nucleasas como control negativo de la reacción. La reacción de PCR se desarrolló en un Termociclador (Eppendorf Mastercycler Gradient) con el siguiente programa de amplificación:1 ciclo de a 94ºC por 3 minutos, 32 ciclos de 94ºC por 60 segundos, 60ºC por 30 segundos y 72ºC por 60 segundos, seguidos de un ciclo de 72 por 5 minutos. La corrida se realizó en gel de agarosa (Sigma) al 1 % con TBE 0,5X, en cámara de electroforesis 2012 Maxiphor (LKB Bromma) con fuente (ShandonSouthern), a 100 Volts y 50 mA, durante 30 minutos. Los geles se tiñeron n bromuro de etidio con 0,5 μg/mL y los resultados se visualizaron en un transluminador de luz ultravioleta MacroVue (Pharmacia). Se utilizó un marcador de peso molecular de 100 pb (Promega).

La temperatura de hibridación del ensayo se evaluó entre el rango de 50ºC a 60ºC y se mantuvieron constantes el resto de los parámetros de la reacción.

Para la determinación de la concentración óptima de MgCl2 se realizó una curva partiendo desde 0,5 mM hasta 4,5 mM, con incrementos de 0,5 mM (13,14). Para determinar este parámetro se trabajó con la temperatura de hibridación obtenida anteriormente. En la determinación de la concentración óptima de cebadores se emplearon concentraciones desde 0,1 uM hasta 0,6 uM, con incrementos de 0,1 uM, según lo descrito por Bolivar et al. (15). La PCR se realizó con la temperatura de unión y concentración de MgCl2 óptimas seleccionadas previamente.

Se realizaron diluciones seriadas del ADN de cada una de las cepas (10 ng/μL- 1fg/μL), según lo recomienda Santos et al. (16). En el caso de la especificidad, el ensayo se realizó según lo recomienda la Farmacopea Europea (17) para la evaluación de la especificidad en los ensayos de PCR para la detección de micoplasmas contaminantes en cultivos celulares.

Los estudios de factibilidad se consideran como una etapa preliminar antes de la optimización (19). Esta fase nos indica si podemos o no continuar con el proceso de estandarización, lo cual depende de la correcta elección de los cebadores y del ADN blanco, parámetros críticos a tener en cuenta para el desarrollo de un sistema de PCR (20).

En la Figura 1 se puede observar la amplificación del ADN diana para cada una de las especies estudiadas, según lo descrito por Kazemiha et al. (12).

Figura 1. 

Electroforesis en gel de agarosa al 1 % de los productos amplificados por PCR. PPM: Patrón de peso molecular de 100 pb (Promega); Línea 1: M. hyorhinis (346 pb); Línea 2: M. fermentans (324 pb); Línea 3: A. laidlawii (300 pb); Línea 4: M. salivarium (434 pb); Línea 5: M. orale (325 pb); Línea 6: M. arginini (326 pb); Línea 7: control negativo de la reacción, agua libre de nucleasas. / Agarose gel electrophoresis at 1 % of PCR-amplified products PPM: 100 bp molecular weight marker (Promega); Line 1: M. hyorhinis (346 bp); Line 2: M. fermentans (324 bp); Line 3: A. laidlawii (300 bp); Line 4: M. salivarium (434 bp); Line 5: M. orale (325 bp); Line 6: M. arginini (326 bp); Line 7: negative reaction control, nuclease-free water.

El sistema de PCR es reproducible en estas condiciones, pues se observa la amplificación de los ADN diana de las cepas utilizadas y los amplicones de cada una de ellas se corresponde con lo descrito por Kazemiha et al. (12) y Timenetsky et al. (21). La temperatura de alineamiento (Ta) es un parámetro crítico que necesita optimizarse en el PCR. Generalmente, la Ta adecuada comprende un rango de ±5ºC del cebador con la menor temperatura de fusión (22). Como resultado de este trabajo se evidencia, en todas las especies estudiadas, amplificaciones con Ta de 60ºC y 60,5ºC, aunque se observan pequeñas diferencias en la intensidad de las bandas amplificadas con respecto al resto de las temperaturas empleadas (Fig. 1). Estos resultados pueden estar dados porque las Ta muy elevadas tienden a disminuir la sensibilidad del método, pues los cebadores se unirán a la banda específica, pero con una fuerza y probabilidad de unión muy pequeñas. Por otra parte, la obtención de bandas de menor intensidad en las Ta cercana a 50ºC, para la mayoría de las especies trabajadas, puede estar dado porque a temperaturas bajas de alineamiento se obtienen productos inespecíficos (23).

Figura 2. 

Electroforesis en gel de agarosa al 1 %. Determinación de la temperatura de hibridación óptima para cada especie. PPM: Patrón de peso molecular de 100 pb (Promega); Línea 1-12: temperaturas (50ºC; 50,2ºC; 50,7ºC; 51,6ºC; 52,8ºC; 54,1ºC; 55,4ºC; 56,9ºC; 57,1ºC; 59,2ºC; 60ºC; 60,5ºC), Línea 13: control negativo de la reacción, agua libre de nucleasas. / Agarose gel electrophoresis at 1 %. Determination of the optimal hybridization temperature for each species. PPM: 100 bp molecular weight marker (Promega); Line 1-12: temperatures (50ºC; 50.2ºC; 50.7ºC; 51.6ºC; 52.8ºC; 54.1ºC; 55.4ºC; 56.9ºC; 57.1ºC; 59.2ºC; 60ºC; 60.5ºC), Line 13: negative reaction control, nuclease-free water.

A partir de estos resultados, se seleccionó 55ºC como la temperatura óptima de alineamiento para los PCR especie-específicos que se optimizan, lo cual coincide con Sung et al. (24), Guevara (25) y Espinosa (26), quienes recomiendan utilizar Ta entre 50ºC y 58ºC. No obstante, es importante señalar que la selección de la Ta está en correspondencia con la Tm de los cebadores que se utilizan en cada ensayo y siempre debe tenerse presente, en la selección de la misma, la no formación de dímeros o que no afecte la especificidad y la sensibilidad del mismo.