Artículo Original
 
Ocurrencia de Babesia spp. en perros sin dueño de La Habana, Cuba
Occurrence of Babesia spp. in stray dogs from Havana, Cuba
 

iDLisset Roblejo-Arias**Los autores Lisset Roblejo-Arias y Cristian Díaz-Corona tuvieron la misma contribución.

iDCristian Díaz-Corona**Los autores Lisset Roblejo-Arias y Cristian Díaz-Corona tuvieron la misma contribución.

iDAdrian Alberto Díaz-Sánchez

iDEvelyn Lobo-Rivero

iDRoxana Marrero-Perera

iDElianne Piloto Sardiñas

iDBelkis Corona-González

iDErnesto Vega-Cañizares*✉:evega@censa.edu.cu

 

Centro Nacional de Sanidad Agropecuaria (CENSA), Apartado 10, CP 32 700, San José de las Lajas, Mayabeque, Cuba.

 

*Autor para la correspondencia: Ernesto Vega Cañizares. E-mail: evega@censa.edu.cu.

 

RESUMEN

Los perros pueden ser afectados por varias especies del género Babesia que causan enfermedades importantes en diferentes regiones del mundo. Dentro de estas especies se encuentran Babesia canis, B. vogeli, B. rossi, B. gibsoni y B. vulves. El presente trabajo tuvo como objetivo detectar la presencia de Babesia spp. en perros sin dueño de La Habana. Se estudiaron 60 perros, a los que se les realizó examen hematológico, frotis sanguíneo y PCR, que amplifica el ARNr 18S. Tres animales (5 %) presentaron valores de hematocrito superiores a los valores de referencia y 23 (38,3 %) mostraron valores de hematocrito inferiores, lo que indica la presencia de un síndrome anémico en estos perros. Como resultado del leucograma, cinco perros (8,3 %) tenían leucocitosis y 7 (11,6 %) leucopenia; 31 animales estaban infestados con garrapatas Rhipicephalus sanguineus sensu lato y 10 estaban coinfestados con Rhipicepahalus microplus. El 20 % de las muestras fueron positivas por PCR, mientras que en la examinación microscópica solo en el 13,3 % de las muestras se observaron merozoitos de Babesia spp. Se observó relación entre los animales positivos por PCR y la disminución del valor del hematocrito. No existió asociación entre la presencia de garrapatas y el sexo en los animales positivos a Babesia spp. El presente estudio demuestra la presencia de Babesia spp. en perros sin dueño de La Habana.

Palabras clave: 
Babesia spp.; hematocrito; anemia; frotis sanguíneo; PCR.
 
ABSTRACT

Dogs can be affected by several species of the genus Babesia causing important diseases in different regions of the world. Among these species are Babesia canis, B. vogeli, B. rossi, B. gibsoni, and B. vulves. The aim of this study was to detect the presence of Babesia spp. in stray dogs from Havana province. Sixty dogs were studied and subjected to haematological examination, blood smear and PCR, which amplified 18S rRNA. Three animals (5 %) showed hematocrit values higher than reference values while 23 (38.3 %) showed lower hematocrit values, indicating the presence of an anemic syndrome in those dogs. According to the leukogram analysis, five dogs (8.3 %) had leukocytosis and 7 (11.6 %) had leukopenia. Thirty-one animals were infested with Rhipicephalus sanguineus sensu lato ticks and 10 were co-infested with Rhipicepahalus microplus ticks. Twenty percent of the samples tested positive by PCR, while microscopic examination revealed Babesia spp. merozoites in only 13.3 % of the samples. A relationship was observed between PCR-positive animals and the decrease in hematocrit value. There was no association between the presence of ticks and sex in animals positive to Babesia spp. The present study demonstrates the presence of Babesia spp. in stray dogs from Havana province.

Key words: 
Babesia spp.; hematocrit; anemia; blood smear; PCR.
 
 
 
INTRODUCCIÓN

Los perros pueden ser afectados por varios patógenos transmitidos por garrapatas, como Erhrilichia canis, Anaplasma phagocytophilum, Anaplasma platys y varias especies del género Babesia que causan enfermedades importantes en perros de varias regiones del mundo. Dentro de estas especies se puede citar a Babesia canis, B. vogeli, B. rossi y B. gibsoni. (11. Gaunt SD, Beall M J, Stillman BA, Lorentzen L, Diniz P, Chandrashekar R, Breitschwerdt EB. Experimental infection and co-infection of dogs with Anaplasma platys and Ehrlichia canis: hematologic, serologic and molecular findings. Parasit Vectors.2010;3:33.). Varias manifestaciones clínicas y los hallazgos de laboratorio como fiebre, anorexia, anemia y trombocitopenia se presentan en las infecciones con estos patógenos (22. Hoskins JD. Ehrlichial diseases of dogs: diagnosis and treatment. Canine Pract. 1991;16:13-21.); además, en los frotis sanguíneos se puede observar la presencia de cuerpos compatibles con estos patógenos, de gran importancia en la medicina veterinaria (33. Moreira SM, Bastos CV, Araújo RB, Santos M, Passos LMF. Retrospective study (1998-2001) on canine ehrlichiosis in Belo Horizonte, M G, Brazil. Arq Bras Med Vet Zootec.2003;55:141-147.).

Los ensayos de inmunofluorescencia son las pruebas de diagnóstico serológico más ampliamente utilizadas para la babesiosis canina en los últimos 30 años; sin embargo, la baja especificidad debido a las reacciones cruzadas entre Babesia spp. y otros parásitos ha sido un factor limitante para continuar con su uso (44. Aboge GO, Jia H, Terkawi MA, Goo Y, Kuriki K, Nishikawa Y, et al. A novel 57-kDa merozoite protein of Babesia gibsoniis a prospective antigen for diagnosis and serosurvey of canine babesiosis by enzyme-linked immunosorbent assay. Vet Parasitol. 2007;149:85-94.). Los ensayos de PCR han aumentado en gran medida la sensibilidad y especificidad de la detección del parásito y se adaptan bien a estudios epidemiológicos y filogenéticos para el diagnóstico de la babesiosis (55. Ikadai H, Tanaka H, Shibahara N, Matsuu A, Uechi M, Itoh N, et al. Molecular evidence of infections with Babesia gibsoni parasites in Japan and evaluation of the diagnostic potential of a loop-mediated isothermal amplification method. J Clin Microbiol. 2004;42:2465-2469.).

En América Latina la babesiosis en perros es causada principalmente por Babesia vogeli y Babesia gibsoni (66. Dantas-Torres F, Figueredo LA. Canine babesiosis: a Brazilian perspective. Vet Parasitol. 2006;141:197-203.-88. Kelly PJ, Xu C, Lucas H, Loftis A, Abete J, Zeoli F, et al. Ehrlichiosis, babesiosis, anaplasmosis and hepatozoonosis in dogs from St Kitts. West Indies. PLoS One. 2013;8:e53450.). La enfermedad se ha reportado específicamente en América del Sur, mientras que los reportes de América Central son escasos. Se considera que en América Latina Babesia vogeli se transmite directamente por la picadura de la garrapata Rhipicephalus sanguineus s.l., mientras que B. gibsoni se pudiera transmitir a través de transferencia de sangre por mordeduras, transfusiones de sangre o por vía transplacental (99. Irwin PJ, Hutchinson GW. Clinical and pathological findings of Babesia infection in dogs. AustVet J.1991;68:204-209.).

En Cuba, el género Babesia se ha informado en perros, pero su diagnóstico se ha basado en la observación de signos clínicos, hallazgos hematológicos, observación directa mediante frotis de sangre y la detección de anticuerpos a través de métodos serológicos (1010. Pérez B, Valdés R, Vitorte S. Epidemiología de las enfermedades trasmitidas por garrapatas en Cuba. Revista Cubana de Ciencias Ve terinarias. 2002;20:78-87.). Estas técnicas no permiten realizar un diagnóstico certero, debido a la similitud de los síntomas clínicos con otros hemoparásitos que pueden afectar a los perros y la baja sensibilidad de estos métodos (1111. Mylonakis ME, Koutinas AF, Billinis C, Leontides LS, Kontos V, Papadopoulos O, et al. Evaluation of cytology in the diagnosis of acute canine monocytic ehrlichiosis (Ehrlichia canis): a comparison between five methods. Vet Microbiol. 2003;91:197-204. ,1212. Ramos CA, Ramos RA, Araújo FR, GuedesJr D, Souza II, Ono TM, et al. Com paração de nested-PCR com o diagnóstico direto na detecção de Ehrlichia canis e Anaplasma platys em cães. Rev Bras Para sitol Vet. 2009;18:58-62.).

González et al. (1313. González N, Dias C, Bezerra da S, Sandes P, Dias U, Cabezas- Cruz A, et al. Molecular detection of Ehrlichi acanis and Babesia canis vogeli in Rhipicephalus sanguineus sensu lato ticks from Cuba. Rev Bras MedVe t.2016;38(Supl.3):63-67.) realizaron la primera detección molecular de B. vogeli infectando garrapatas R. sanguineus s.l. colectadas de perros con dueño y plantearon la necesidad de la detección de las especies de Babesia infectando perros, así como determinar la asociación de R. sanguineus s.l. en la transmisión de estos hemoparásitos en animales de compañía en Cuba; sin embargo, hasta la fecha no se han realizado estudios de este tipo en perros sin dueño, los cuales pueden constituir una importante fuente de infección de enfermedades transmitidas por garrapatas en las zonas urbanas y suburbanas de Cuba. El presente trabajo tuvo como objetivo detectar la presencia de Babesia spp. en perros sin dueño de La Habana.

MATERIALES Y MÉTODOS
Toma de muestras

Para la recolección de las muestras se realizó un estudio transversal, con una observación única, durante el periodo de septiembre de 2016 a julio de 2018, a 60 perros sin dueño, procedentes de 11 municipios de la provincia La Habana (Boyeros, Habana Vieja, Playa, Guanabacoa, Habana del Este, Arroyo Naranjo, Cotorro, Centro Habana, La Lisa, Marianao y 10 de octubre) que fueron capturados por el Centro de Control Contra las Zoonosis.

A los animales se les realizó examen físico y se les determinó la temperatura rectal. De cada animal se registraron los datos referentes a sexo y presencia de garrapatas.

Extracción de la sangre

La sangre se obtuvo mediante punción de la vena yugular, utilizando agujas hipodérmicas calibre 25 X 0,8 mm (21G) y tubos para extracción de sangre por sistema de vacío de 4 mL (BD Vacutainer®), con 7,2 mg de EDTA K2 como anticoagulante. Una parte de la sangre colectada se empleó para el análisis de los parámetros hematológicos y realización del frotis sanguíneo, y el resto se conservó en crioviales (Neogene) a -20ºC para posteriormente realizar la extracción de ADN.

Análisis hematológico

Se determinó el hematocrito (Hto) y se realizó conteo de leucocitos totales (LT). Para determinar el hematocrito se utilizó una centrífuga de microhematocrito (JOVEL Hema-C). El conteo de LT se realizó mediante una cámara de Neubauer, con el empleo de ácido acético 2 % y sangre diluida 1/20. Los parámetros hematológicos se analizaron comparando con los valores de referencia descritos para la especie canina por Ettinger y Feldman (1414. Ettinger SJ, Feldman EC. Tratado de medicina interna veterinaria. 5 ed. ISBN 2910002278926. 2007.). Todas las muestras se trabajaron en las primeras 24 horas después de la recolección. Los niveles de Hto se clasificaron con relación a la severidad de la anemia según lo descrito por Piratae et al. (1515. Piratae S, Sae-chue B, Sukumolanan P, Phosri A. Molecular detection of blood pathogens and their impacts on levels of packed cell volume in stray dogs from Thailand. Asian Pac J Trop Dis. 2017;7(4):233-236.): ≥0,37 L/L (no anemia), 0,30-0,36 L/L (anemia media), 0,20-0,29 L/L (anemia moderada) y ≤0,20 L/L (anemia severa).

Colecta de garrapatas

El examen para la colecta de garrapatas se realizó según lo describen Shoorijeh et al. (1616. Shoorijeh SJ, Ghasrodashti AR, Tamadon A, Moghaddar N, Behzadi MA. Seasonal frequency of ectoparasite infestation in dogs from Shiraz, Southern Iran. Turkish J Vet Anim Sci. 2008;32:309-313.). De cada animal se trató de extraer al menos 10 de las garrapatas presentes.

Las garrapatas se retiraron manualmente y, en algunos casos, se utilizaron pinzas planas, que se colocaron tan cerca como fuera posible al capítulo de las garrapatas, para evitar el deterioro de la muestra. Las garrapatas colectadas se preservaron en etanol al 70 % y se transportaron al laboratorio en recipientes rotulados para su identificación en un microscopio estereoscopio (Leica, Wetzlar, Alemania). Para la identificación taxonómica se empleó la clave publicada por Nava et al. (1717. Nava S, Venzal JM, González-Acuña D, Martins TF, Guglielmone AA. Chapter 2 - Genera and Species of Ixodidae. En: Nava S, Venzal JM, González-Acuña D, Martins TF, Guglielmone AA, editor(es). In Ticks of the Southern Cone of America. Academic Press.2017:25-267.). Las garrapatas colectadas de cada animal se agruparon por especie, estadio y sexo; se depositaron en tubos plásticos estériles de 1,5 mL y se conservaron a -80°C para estudios posteriores.

Diagnóstico por frotis sanguíneo

Las extensiones se fijaron con metanol absoluto (Uni-Chem) y se tiñeron durante 30 minutos con Giemsa, según Holbrook et al. (1818. Holbrook A, Johnson A, Madden P. Equine Piroplasmosis intraerithrocytic development of Babesia caballi (Nutall) and Babesia equi (Laveran). American J Vet Res. 1968;29(2):297.). La lectura se realizó en un microscopio óptico (Carl Zeiss Microscopy GmbH, Jena, Alemania), con lente de inmersión a una magnificación final de 1000X. Se analizaron 25 campos por lámina como mínimo, en la periferia del frotis sanguíneo (cola del frotis sanguíneo) para determinar la presencia de Babesiaspp. La identificación de estos hemoparásitos se realizó basada en parámetros morfológicos y biométricos, tales como la forma, la localización y el tamaño. Las formaciones compatibles con Babesia spp. se identificaron como inclusiones intracitoplasmáticas, ubicadas en los eritrocitos, en forma de peras, simples, pariadas o múltiples; según lo descrito por Lempereur et al. (1919. Lempereur L, Beck R, Fonseca I, Marques C, Duarte A, Santos M, et al. Guidelines for the Detection of Babesia and Theileria Parasites. Vector borne and zoonotic diseases. 2017;17(1):doi:10.1089/vbz.2016.19552017.) o extracelulares, según Ćoralić et al. (2020. Ćoralić A, Gabrielli S, Zahirović A, Stojanović NM, Milardi GL, Jažić A, et al. First molecular detection of Babesia canis in dogs from Bosnia and Herzegovina. Ticks Tick-borne Dis. 2018;9(2):363-368. ).

Extracción y calidad del ADN

Se utilizaron 300 µL de sangre con anticoagulante para la extracción del ADN mediante el juego de reactivos Genomic DNA Purification Kit (Promega, Madison, EE.UU), según las indicaciones del fabricante. El ADN se resuspendió en 100 uL de solución tampón de elusión (Promega). La calidad y concentración del ADN se determinaron en el equipo Thermo Scientific Nanodrop 2000 Spectrophotometer.

Para detectar la presencia de posibles inhibidores en el ADN extraído, se amplificó un fragmento del gen gapdh (gliceraldehido 3 fosfato deshidrogenasa), según los cebadores y las condiciones de amplificación descritos por Birkenheuer et al. (2121. Birkenheuer AJ, Levy MG, Breitschwerdt EB.Development and evaluation of seminested PCR for detection and differentiation of Babesia gibsoni (Asian genotype) and B. canis DNA in canine blood samples. J Clin Microbiol. 2003;41:4172-4177.), que amplifican una región de 346-400 pb.

Diagnóstico de Babesia spp.

Se seleccionaron los cebadores descritos por Birkenheuer et al. (2121. Birkenheuer AJ, Levy MG, Breitschwerdt EB.Development and evaluation of seminested PCR for detection and differentiation of Babesia gibsoni (Asian genotype) and B. canis DNA in canine blood samples. J Clin Microbiol. 2003;41:4172-4177.) con los que se amplifica en un primer ensayo de PCR los genes ARNr 18S de Babesia y en un segundo ensayo de PCR se amplifica una región de aproximadamente 340 pb dentro de este gen (Tabla 1).

 
Tabla 1.  Secuencia de los cebadores para la detección por PCR de Babesia spp. / Sequence of primers for the detection of Babesia spp. by PCR.
Secuencia [5´……. 3´]Gen a amplificarReferencia
5´ GTTGATCCTGCCAGTAGT3´ARNr 18SBirkenheuer et al. (2121. Birkenheuer AJ, Levy MG, Breitschwerdt EB.Development and evaluation of seminested PCR for detection and differentiation of Babesia gibsoni (Asian genotype) and B. canis DNA in canine blood samples. J Clin Microbiol. 2003;41:4172-4177.)
5´AACCTTGTTACGACTTCTC3´
5´GTCTTGTAATTGGAATGATGGTGAC3´
5´ATGCCCCCAACCGTTCCTATTA3´
 

Como control positivo de los ensayos de PCR, se utilizó ADN de Babesia canis, gentilmente donado por el Laboratorio de Enfermedades Parasitarias de la Universidad Federal Rural de Rio de Janeiro (UFRRJ), Brasil.

Los ensayos de PCR se realizaron en un volumen final de 25 μL, conteniendo 1X GoTaq® Green Master Mix (Promega, Madison, EE.UU.), 0,8 μM de cada cebador. En el PCR1 se utilizaron 2 μL de ADN y en el PCR2 se utilizó 1 uL del PCR1. Todos los reactivos se manipularon en flujo laminar (Ikem), usando puntas con filtros (Eppendorf) resistentes a aerosoles. Las reacciones se desarrollaron en un termociclador Eppendorf Mastercycler gradient 96 (Eppendorf AG, Hamburgo, Alemania), y se utilizó un programa de amplificación que consistió en un ciclo de 95°C durante 5 minutos, seguido de 35 ciclos de 95°C por 45 segundos, 58°C durante 30 segundos, 72°C por 45 segundos y una extensión final de 72°C durante 10 minutos.

Visualización de los resultados del PCR

Los resultados del PCR se aplicaron en geles de agarosa (Sigma-Aldrich, St. Louis, MI, EE.UU.) al 2% en tampón TBE 0,5X, se corrieron a 100 Volts y 50 mA en cámara de electroforesis Maxiphor 2012 (LKB, Bromma, Suecia), durante 35 minutos en tampón de corrida (TBE 0,5X). Los geles se tiñeron con Bromuro de Etidio (0,5 μg/mL) durante 15 minutos y los resultados se visualizaron en un transiluminador de luz ultravioleta Macro Vue (Pharmacia Biotech Inc., EE.UU.). En todos los casos se utilizó un marcador de peso molecular de 100 pb (Promega, Madison, EE.UU.).

Análisis estadístico

Los datos se agruparon conformando una base de datos en Microsoft Excel 2016 (Microsoft Corporation, Redmond, WA). Se determinaron los estadígrafos de dispersión valor máximo, valor mínimo y su desviación estándar, así como el estadígrafo de tendencia central, valor medio, del Hto y los LT.

La prueba t de Student se utilizó para determinar si existían diferencias entre la media del valor del Hto de animales positivos y negativos a Babesia spp. por PCR. Las diferencias se consideraron estadísticamente significativas para p≤0,05. Se utilizó la prueba exacta de Fisher para determinar si existía asociación entre las variables infestación por garrapatas y el sexo del animal, con la infección por Babesia spp. El análisis de los datos obtenidos se realizó con el empleo del Software R, Package stats version 3.6.0. (R Development Core Team, 2019) con un 95 % de intervalo de confianza (IC).

Consideraciones éticas

En todos los casos se emplearon los métodos de manejo y sujeción correctos para el procedimiento, según lo describe Radostits et al. (2222. Radostits MO, Mayhew GJ, Houston MD. Examen y diagnóstico clínico en veterinaria. EE.UU: Ediciones Harcourt, Saunders. 2002.). Las muestras se colectaron por veterinarios clínicos; las normas éticas y de bienestar animal (Organización Mundial para la Sanidad Animal, 2010) se respetaron estrictamente. Se siguieron, además, los principios de la Guía Internacional para investigaciones biomédicas que involucran animales (2323. International Guiding Principles for Biomedical Research Involving Animals. Council for International Organization of Medical Sciences and the International Council for Laboratory Animal Science.2012.).

RESULTADOS Y DISCUSIÓN

De los 60 animales en estudio, 27 (45 %) eran hembras y 33 (55 %) machos. A la exploración clínica 13/60 (21,6 %) animales tenían temperaturas ≥ 39,5°C y no mostraban signos de deshidratación.

 
Tabla 2.  Valores medio, máximo, mínimo y desviación estándar de los parámetros hematológicos determinados en sangre de perros sin dueño de La Habana. / Mean, maximum, minimum and standard deviation values of hematological parameters determined in the blood of stray dogs from Havana province.
ParámetrosHtoLT
Valores Normales0,37-0,55 L/L6-17 x109c/L
X ± DS0,38 ± 0,1010,21 ± 4,08
Vmax / Vmin0,76 / 0,1621,10 / 3,62

Leyenda: Vmin: Valor mínimo; Vmax: Valor máximo; X: media; DS: desviación estándar.

 

En la Tabla 2 se puede observar el comportamiento de los parámetros hematológicos. La media de los valores de Hto y LT estuvo entre los valores de referencia descritos para la especie canina por Ettinger y Feldman (1414. Ettinger SJ, Feldman EC. Tratado de medicina interna veterinaria. 5 ed. ISBN 2910002278926. 2007.). Sin embargo, el valor mínimo para estos parámetros fue inferior y el valor máximo superior a los valores de referencia.

Al analizar los valores del Hto, tres (3/60) animales (5 %) presentaban valores superiores a los descritos por Ettinger y Feldman (1414. Ettinger SJ, Feldman EC. Tratado de medicina interna veterinaria. 5 ed. ISBN 2910002278926. 2007.) y 34 (56,6 %) mostraron valores de hematocrito dentro de los valores de referencia. Se plantea que estos valores están presentes en caninos con un estado de salud aceptable o en aquellos casos donde existe una hemoconcentración producto a la deshidratación del animal, que puede incrementar en forma falsa los indicadores de la masa de glóbulos rojos. Este último criterio se reporta de manera común en perros callejeros (2424. Constantino C, Ferraz E, Paula A, Brandão D, Ferreira F, da Costa Vieira RF et AL. Survey of spatial distribution of vector-borne disease in neighborhood dogs in southern Brazil. Open Vet J. 2017;7(1):50-56.); sin embargo, en el presente estudio no se incluyeron animales con estado de deshidratación.

El 38,3 % de los animales analizados (23/60) mostraron un valor de hematocrito inferior a 0,37 L/L; 10 animales (16,6 %) tenían anemia media, 11 (18,3 %) anemia moderada y dos animales (3.3 %) anemia severa, según la clasificación descrita por Piratae et al. (1515. Piratae S, Sae-chue B, Sukumolanan P, Phosri A. Molecular detection of blood pathogens and their impacts on levels of packed cell volume in stray dogs from Thailand. Asian Pac J Trop Dis. 2017;7(4):233-236.). La anemia en estos perros pudiera estar influenciada por la condición de perros callejeros, que carecen de una alimentación adecuada, y tienen mayor exposición a microorganismos patógenos causantes de pérdidas eritrocitarias.

El resultado del leucograma mostró que 5/60 (8,3 %) presentaron leucocitosis. Estos animales no disponen de cuidados apropiados ni atención médica periódica y están expuestos a un mayor número de enfermedades de diversos orígenes (bacterianas, virales y parasitarias), que pueden producir una estimulación del sistema inmune con un incremento de la serie celular blanca (2525. Furlanello T, Fiorio F, Caldin M, Lubas G, Solano-Gallego L. Clinicpathological findings in naturally occurring cases of babesiosis caused by large babesia from dogs of northeastern Italy. Vet Parasitol. 2005;134:77-85.). Según Buckner y Ewing (2626. Buckner RG, Ewing SA. Canine Babesiosis. In: Kirk R W (ed) Current Veterinary Therapy V. Saunders, Philadelphia. 1974.), durante la fase recuperativa de la babesiosis canina se observa lecocitosis.

Por otra parte, 7/60 (11,6 %) mostraron valores de leucocitos totales por debajo del valor de referencia. Según Mandal (2727. Mandal A. Leukopenia and leukocitosis [en línea]. EEUU. 2013. http://www.news-medical.net ), la leucopenia puede ser provocada por enfermedades virales, sin infección bacteriana secundaria, como la que se presenta en el moquillo canino, la hepatitis infecciosa canina y el parvovirus canino, algunas infecciones bacterianas como toxemias bacterianas, septicemia provocada por salmonelosis y toxoplasmosis aguda; la anafilaxis, las neoplasias de la médula ósea, entre otras patologías. Buckner y Ewing (2626. Buckner RG, Ewing SA. Canine Babesiosis. In: Kirk R W (ed) Current Veterinary Therapy V. Saunders, Philadelphia. 1974.) plantearon que la leucopenia puede estar presente en las primeras etapas de la babesiosis canina.

A la exploración clínica, 31/60 animales (51,6 %) estaban infestados con garrapatas. Se colectaron 69 garrapatas adultas (30 hembras y 39 machos) y tres ninfas de R. sanguineus s.l. (Figs. 1 y 2). Un resultado inesperado fue la casi ausencia de formas inmaduras en la colecta. Es posible que algunas larvas y las ninfas puedan haber sido ignoradas por el examen realizado, pues al tratarse de perros sin dueño, estos se crían más libremente y no están acostumbrados al manejo, lo que pudo dificultar el examen; sin embargo, si hubiera existido infestaciones masivas de larvas y ninfas, aún en estas condiciones de colecta, no se habrían perdido. En este caso, es posible que el corto período de muestreo estuvo fuera de temporada para larvas y ninfas de R. sanguineus s.l. Resultados similares fueron obtenidos por Szabó et al. (2828. Szabó JMP, Marquez CT, Pinter A, Vicentini F.Ticks (Acari: Ixodidae) Associated with Domestic Dogs in Franca Region, São Paulo, Brazil. Exp Appl Acarol. 2001:25: 909-916. https://doi.org/10.1023/A:1020433003028 ), que estudiaron las especies de garrapatas presentes en perros en Brasil y solo encontraron cuatro ninfas de R. sanguineus s.l. en un perro de un área urbana.

 
Figura 1.  Garrapata Rhipicephalus sanguineus s.l. (hembra) colectada de uno de los perros en estudio. / Rhipicephalus sanguineus s.l. tick (female) collected from one of the dogs under study.
 

 
Figura 2.  Garrapata Rhipicephalus sanguineus s.l. (macho) colectada de uno de los perros en estudio. / Rhipicephalus sanguineus s.l. tick (male) collected from one of the dogs under study.
 

La garrapata R. sanguineus s.l. tiene una distribución cosmopolita y el perro constituye el principal hospedero de esta especie en áreas rurales y urbanas (6,29). En islas del Caribe como Granada, Trinidad, Saint Kitts y Nevis, Martinica, Aruba, Puerto Rico y Haití se reporta una alta frecuencia de aparición de esta especie de garrapata en perros (99. Irwin PJ, Hutchinson GW. Clinical and pathological findings of Babesia infection in dogs. AustVet J.1991;68:204-209.,3030. Yabsley MJ, McKibben J, Macpherson CN, et al. Prevalence of Ehrlichia canis, Anaplasma platys, Babesia canis vogeli, Hepatozoon canis, Bartonella vinsonii berkhoffii, and Rickettsia spp. in dogs from Grenada. Vet Parasitol. 2008;151:279-285.-3333. Starkey LA, Newton K, Brunker J, Crowdis K, Edourad EJP, Meneus P, et al. Prevalence of vector-borne pathogens in dogs from Haiti. Vet Parasitol. 2016;224:7-12.). En Cuba, Pérez-Vigueras (1010. Pérez B, Valdés R, Vitorte S. Epidemiología de las enfermedades trasmitidas por garrapatas en Cuba. Revista Cubana de Ciencias Ve terinarias. 2002;20:78-87.) reportó la presencia de la garrapata R. sanguineus en todo el país; sin embargo, Barros-Battesti et al. (3434. Barros-Battesti DM, Hernández MR, Famadas KM, Onofrio VC, Beati L, Guglielmone AA. The ixodid ticks (Acari: Ixodidae) of Cuba. Syst App lAcarol. 2009;14:101-128.) notificaron que esta especie se encuentra distribuida geográficamente hacia la zona occidental de Cuba.

Investigaciones recientes sugieren que R. sanguineus es un taxón con una definición morfológica incierta y se han reunido evidencias irrefutables que respaldan la existencia de un complejo de especies bajo el nombre R. sanguineus s.l., cuyo número de especies en todo el mundo aún no se ha determinado. Esta hipótesis sugiere que el estado taxonómico de R. sanguineus podría requerir revisión (3535. Dantas-Torres F, Otranto D. Further thoughts on the taxonomy and vector role of Rhipicephalus group ticks. Vet Parasitol. 2015;208:9-13.).

En 10 de los perros donde se encontró R. sanguineus s.l. también se colectaron 15 garrapatas adultas hembras y dos ninfas de Rhipicephalus microplus. Estos perros pudieron estar en contacto con otros animales (hospederos principales) infestados con esta especie de garrapata y convertirse en hospederos accidentales. Resultados similares se obtuvieron por Szabó et al. (2828. Szabó JMP, Marquez CT, Pinter A, Vicentini F.Ticks (Acari: Ixodidae) Associated with Domestic Dogs in Franca Region, São Paulo, Brazil. Exp Appl Acarol. 2001:25: 909-916. https://doi.org/10.1023/A:1020433003028 ), que en 140 perros en estudio, cinco estaban infestados con R. microplus y uno tenía infestación mixta con R. sanguineus s.l. Según estos autores, esto podría deberse a que los perros tuvieron intercambio de hábitat con otros animales domésticos o salvajes que actúan como hospederos principales de R. microplus.

A pesar de que R. microplus es la garrapata del ganado bovino, estudios realizados por Ueti et al. (3636. Ueti MW, Palmer GH, Scoles GA, Kappmeyer LS, Knowles DP. Persistently Infected Horses Are Reservoirs for Intrastadial Tick-Borne Transmission of the Apicomplexan Parasite Babesia equi. Infection Immun. 2008;76:3525-3529.) demostraron que es capaz de ser infectada eficientemente por Theileria equi durante la infección aguda y persistente y transmitirlo de forma intraestadial y transestadial a caballos. Estos resultados evidencian la capacidad vectorial de esta garrapata de transmitir patógenos a hospederos accidentales.

En el presente estudio se realizaron los frotis sanguíneos a partir de sangre venosa con anticoagulante, teniendo en cuenta que, con excepción de las especies de Babesia, como Babesia bovis que se acumulan en los capilares y los tejidos, el resto de las especies de Babesia se diagnostica mejor en frotis de sangre venosa con anticoagulante, que en frotis de sangre capilar colectada de la oreja o de la cola (1919. Lempereur L, Beck R, Fonseca I, Marques C, Duarte A, Santos M, et al. Guidelines for the Detection of Babesia and Theileria Parasites. Vector borne and zoonotic diseases. 2017;17(1):doi:10.1089/vbz.2016.19552017.). Es importante conocer que los microorganismos como Babesia spp. están presentes frecuentemente en los márgenes de los frotis de sangre, ya que los eritrocitos que contienen parásitos tienden a migrar a los márgenes durante la preparación del frotis (3737. Schoeman JP. Canine babesiosis. Onderstepoort J Vet. Res. 2009;76:59-66.).

Se observó que 7/60 animales (11,6 %) presentaron formaciones intraeritrocíticas compatibles con Babesia spp. (Fig. 3).Este diagnóstico se basó en las características morfológicas y estructurales descritas para estos hemoparásitos por Lempereur et al. (1919. Lempereur L, Beck R, Fonseca I, Marques C, Duarte A, Santos M, et al. Guidelines for the Detection of Babesia and Theileria Parasites. Vector borne and zoonotic diseases. 2017;17(1):doi:10.1089/vbz.2016.19552017.). Se visualizaron microorganismos intraeritrocíticos en forma de pera en pares o simples. Según estos autores, estas características morfológicas permiten la identificación preliminar de B. canis, B. vogelio B. rossi; sin embargo, se necesita la realización de técnicas moleculares para poder tener una identificación certera de la especie que está presente.

 
Figura 3.  Visualización de cuerpos intraeritrocitarios compatibles con Babesia spp. en frotis sanguíneos de dos perros en estudio. / Visualization of intraerythrocytic inclusion bodies compatible with Babesia spp. observed in blood smears from two dogs under study. .
 

En un animal (1/60) (1,6 %) se observaron merozoitos extracelulares; resultados que coinciden con los descritos por Izzi et al. (3838. Izzi SA, Martin DS, Chan RYY, Leutenegger CM. Babesia canis vogeli, Ehrlichia canis, and Anaplasma platys infection in a dog. Vet Clin Pathol. 2013;42(4):471-475.) y Ćoralić et al. (2020. Ćoralić A, Gabrielli S, Zahirović A, Stojanović NM, Milardi GL, Jažić A, et al. First molecular detection of Babesia canis in dogs from Bosnia and Herzegovina. Ticks Tick-borne Dis. 2018;9(2):363-368. ), quienes encontraron trofozoitos de Babesia spp. en eritrocitos de perros, de forma individual, en parejas o en grupos de cuatro, y también extracelularmente de forma oval a piriforme y que se concentraron principalmente en el borde de los frotis. Izzi et al. (3838. Izzi SA, Martin DS, Chan RYY, Leutenegger CM. Babesia canis vogeli, Ehrlichia canis, and Anaplasma platys infection in a dog. Vet Clin Pathol. 2013;42(4):471-475.) determinaron por PCR en tiempo real que se trataba de B. vogeli.

En la presente investigación, 8/60 (13,3 %) de los animales resultaron positivos a Babesia spp. mediante visualización de los frotis sanguíneos. Ćoralić et al. (2020. Ćoralić A, Gabrielli S, Zahirović A, Stojanović NM, Milardi GL, Jažić A, et al. First molecular detection of Babesia canis in dogs from Bosnia and Herzegovina. Ticks Tick-borne Dis. 2018;9(2):363-368. ), en un estudio realizado en 144 perros con dueño que presentaban signos y síntomas compatibles con hemoparasitosis, encontraron que el 80 % de los animales fueron positivos por examinación de los frotis sanguíneos.

Babesia spp. grandes, previamente se consideraba que eran B. canis, pero en la actualidad están divididas en tres especies separadas: B. canis, B. vogeli y B. rossi (3939. Solano-Gallego L, Sainz Á, Roura X, Estrada-Peña A, Miró G. A review of canine babesiosis: the European perspective. Parasit Vectors. 2016;9:336.). B. canis, transmitida por Dermacentor reticulatus, es la especie de Babesia más común en Europa y Asia y se describe que puede aparecer simple o pareada, pero usualmente aparece pareada y las formas piriformes tienen un tamaño entre 2,5-3 X 5 µm. En las regiones tropicales y subtropicales R. sanguineus s.l. es el vector de B. vogeli, una especie grande, que puede aparecer simple o pareada con un tamaño de 2,5 X 4,5 µm, siendo menor que B. canis. B. rossi se describe en regiones de África y se transmite por Haemaphysalis elliptica (formalmente H. leachi) (4040. Solano-Gallego L, Baneth G. Babesiosis in dogs and cats-expanding parasitological and clinical spectra. Vet Parasitol. 2011;181:48-60.). Esta especie también puede aparecer en forma de peras simples o pareadas con un tamaño similar a B. vogeli.

B. gibsoni y B. vulpes son piroplasmas pequeños, que también pueden causar babesiosis en perros (1919. Lempereur L, Beck R, Fonseca I, Marques C, Duarte A, Santos M, et al. Guidelines for the Detection of Babesia and Theileria Parasites. Vector borne and zoonotic diseases. 2017;17(1):doi:10.1089/vbz.2016.19552017.). B. gibsoni se describe en Asia, Estados Unidos y Europa, con un tamaño de 1,2-2 X 2-3,2 µm y con formas piriformes o ameboides. B. vulpes está descrita en varios países de Europa y se observa en forma de pera simple con un tamaño de 2,5 X 1 µm (4141. Baneth G, Florin-Christensen M, Cardoso L, Schnittger L. Reclassification of Theileria annae as Babesia vulpes sp. Nov. ParasitVectors.2015;8:207.).

Barros-Battesti et at. (2009) describieron la presencia en Cuba de nueve especies de Ixodes. Entre las garrapatas que pueden transmitir a los perros las especies de Babesia mencionadas con anterioridad, solo está presente en Cuba R. sanguineus s.l. González et al. (1313. González N, Dias C, Bezerra da S, Sandes P, Dias U, Cabezas- Cruz A, et al. Molecular detection of Ehrlichi acanis and Babesia canis vogeli in Rhipicephalus sanguineus sensu lato ticks from Cuba. Rev Bras MedVe t.2016;38(Supl.3):63-67.) describieron la presencia de B. vogeli en garrapatas R. sanguineus s.l. colectadas de perros con dueño de La Habana mediante ensayos de PCR anidado. Teniendo en cuenta estos precedentes y los resultados obtenidos de la visualización de los frotis sanguíneos, se pudiera inferir que la especie que se visualizó seaB. vogeli; pero estos resultados tienen que ser confirmados con ensayos de PCR especie-específicos y secuenciación, debido a que el rango geográfico de piroplasmas infectando perros parece estar expandiéndose, la ubicación no debería utilizarse como único criterio para la identificación de especies o subespecies (2121. Birkenheuer AJ, Levy MG, Breitschwerdt EB.Development and evaluation of seminested PCR for detection and differentiation of Babesia gibsoni (Asian genotype) and B. canis DNA in canine blood samples. J Clin Microbiol. 2003;41:4172-4177.).

Según Miró et al. (4242. Miró G, Checa R, Paparini A, Ortega N, González-Fraga JL, Gofton A, et al. Theiler iaannae (syn. Babesia microti-like) infection in dogs in NW Spain detected using direct and indirect diagnostic techniques: clinical report of 75 cases. Parasites and Vectors.2015;8:217.), mediante la visualización de los frotis sanguíneos no es posible realizar la diferenciación de las especies. En la India, las enfermedades transmitidas por garrapatas se han diagnosticado por métodos que utilizan la observación microscópica de frotis de sangre; sin embargo, Amritpal et al. (4343. Amritpal S, Harkirat S, Singh NK, Singh ND, Rath SS.Canine Babesiosis in Northwestern India. Molecular Detection and Assessment of Risk FactorsBioMed Res Internat. 2014;(74):5.) plantean que este método no permite la identificación confiable de la especie.

En lo que respecta al diagnóstico de babesiosis canina, el examen microscópico directo del frotis de sangre teñido es el método más comúnmente utilizado, ya que es factible de realizar, pero no necesariamente detecta los parásitos en perros con infecciones no aparentes o crónicas, debido a que el nivel de parasitemia es muy bajo (4444. Karunakaran S, Pillai UN, Sasidharan HP. Babesia gibsoni infection in a German shepherd dog. Vet World. 2011;4:269-270.). En el presente estudio, por tratarse de perros callejeros, resulta difícil poder determinar la presencia de la mayoría de los signos clínicos relacionados con la babesiosis canina. Según Quiroz (4545. Quiroz R. Parasitología y enfermedades parasitarias de animales domésticos. México. Limusa. 1984; p. 876.), en los casos crónicos la fiebre falta totalmente o puede observarse en los primeros días de la enfermedad o es de tipo intermitente en algunos casos.

La microscopía sigue siendo la más simple y accesible prueba de diagnóstico para la mayoría de los veterinarios y, durante la fase aguda, la microscopía de infecciones es razonablemente sensible para detectar parásitos intraeritrocíticos en frotis de sangre teñidos con Giemsa o con tinción de Wright, pues permite la diferenciación entre las babesias grandes y las pequeñas. Sin embargo, para poder determinar la especie se necesitan herramientas moleculares (4242. Miró G, Checa R, Paparini A, Ortega N, González-Fraga JL, Gofton A, et al. Theiler iaannae (syn. Babesia microti-like) infection in dogs in NW Spain detected using direct and indirect diagnostic techniques: clinical report of 75 cases. Parasites and Vectors.2015;8:217.).

Todos los ADN tenían la concentración y calidad requeridas para ser utilizados en ensayos de PCR, según el análisis por espectrofotometría. Con el ensayo de PCR para el gen gapdh, en todas las muestras se amplificó un fragmento entre 346 y 400 pb, lo que demuestra que no hay presencia de inhibidores y que los ADN tienen la calidad requerida para ser usados en ensayos de PCR.

Como resultado del diagnóstico molecular mediante PCR, 12/60 (20 %) animales resultaron positivos a la presencia de Babesia spp. En todas las muestras positivas se visualizó una banda de 340 pb, lo que se corresponde con lo descrito para este ensayo por Birkenheuer et al. (2121. Birkenheuer AJ, Levy MG, Breitschwerdt EB.Development and evaluation of seminested PCR for detection and differentiation of Babesia gibsoni (Asian genotype) and B. canis DNA in canine blood samples. J Clin Microbiol. 2003;41:4172-4177.). Resultados similares se describieron por Agustine et al. (246), cuando emplearon este ensayo para el diagnóstico de Babesia spp. en perros naturalmente infectados de Kerala, India.

El gen ARNr 18S es el gen más comúnmente utilizado para el diagnóstico de Babesia spp. y de las especies, debido a su conservación y la repetición dentro del genoma que proporciona una amplia cantidad de ADN blanco para ser amplificado mediante PCR (4747. Allsopp M, Allsopp B. Molecular sequence evidence for the reclassification of some Babesia species. Ann N Y Acad Sci. 2006;1081:509-517.). Para la identificación de las especies se pueden utilizar ensayos de PCR anidado especie-específicos (2121. Birkenheuer AJ, Levy MG, Breitschwerdt EB.Development and evaluation of seminested PCR for detection and differentiation of Babesia gibsoni (Asian genotype) and B. canis DNA in canine blood samples. J Clin Microbiol. 2003;41:4172-4177.) o métodos moleculares alternativos (4848. Hurtado A. Reverse line blot hybridization with species-specific oligonucleotide probes: Application to piroplasm detection. Methods Mol Biol. 2015;12(47):183-192.-5050. Bonnet S, Michelet L, Moutailler S, Cheva J, Hébert C, Vayssier-Taussat M, et al. Identification of parasitic communities within European ticks using next-generation sequencing. PLoS. Negl. Trop. Dis. 2014;8:e2753.).

En la detección de Babesia spp. el frotis sanguíneo mostró un bajo desempeño con respecto al PCR. El 20 % de las muestras fueron positivas por PCR, mientras que en la examinación microscópica solo en el 13,3 % de las muestras se observaron merozoitos de Babesia spp. Resultados similares se obtuvieron por O’Dwyer et al. (5151. O’Dwyer LH, Lopes VVA, Rubini AS, Paduan KDS, Ribolla PEM. Babesia spp. infection in dogs from rural areas of Sao Paulo State Brazil. Rev Bras Parasitol Vet Jaboticabal.2009;18:23-26.), pues reportaron el 8 % de las muestras positivas por PCR y solo en el 2 % se observaron los merozoitos de Babesia spp.

Los resultados obtenidos por ambas técnicas corroboran que el frotis sanguíneo no es una prueba diagnóstica lo suficientemente sensible para la identificación de animales en la fase crónica de la enfermedad, ya que no necesariamente detecta los parásitos en perros con infecciones no aparentes o crónicas, debido a que el nivel de parasitemia es muy bajo (4444. Karunakaran S, Pillai UN, Sasidharan HP. Babesia gibsoni infection in a German shepherd dog. Vet World. 2011;4:269-270.).

La Tabla 3 muestra una comparación de las medias del valor del Hto entre los animales positivos y negativos a Babesia spp. por PCR. La media del Hto de los animales positivos a Babesia spp. está por debajo de los valores de referencia. Los animales negativos tienen una media del valor del hematocrito estadísticamente significativa superior a la media de los animales positivos.

 
Tabla 3.  Comparación de los valores de hematocrito entre animales positivos y negativos a Babesia spp. por PCR. / Comparison of hematocrit values between animals positive and negative to Babesia spp. by PCR. .
VariablePCRnMediaMedianaD.S.E.E.p
Hto (0,37-0,55 L/L)Negativos480,3990,4000,1020,01470,02
Positivos120,3190,3500,09740,0281

D.S.: Desviación estándar; E.E.:Error estándar

 

Se observa una relación entre los animales positivos y la disminución del valor del Hto que coincide con los resultados encontrados por Avinash et al. (5252. Avinash KB, Ghanshyam CM, Falguni BT. Clinicopathological alterations in naturally occurring Babesia gibsoni infection in dogs of Middle-South Gujarat, India. Vet World. 2017;10(10):1227-1232. doi: 10.14202/vetworld.2017.1227-1232 ), quienes reportaron una disminución estadísticamente significativa del valor del Hto, el recuento total de eritrocitos y la concentración de hemoglobina en perros positivos a Babesia spp. en comparación con perros sanos.

Según Ćoralić et al. (2020. Ćoralić A, Gabrielli S, Zahirović A, Stojanović NM, Milardi GL, Jažić A, et al. First molecular detection of Babesia canis in dogs from Bosnia and Herzegovina. Ticks Tick-borne Dis. 2018;9(2):363-368. ), la anemia y el íctero se pueden tener en cuenta como parámetros clínicos que indican fuertemente infección por Babesia spp. La anemia puede ser causada por efectos mecánicos, inmunológicos y tóxicos del parásito, lo que provoca ictericia como consecuencia de la lisis de los eritrocitos. La hemólisis de eritrocitos infectados, debido al daño directo inducido por parásitos,es un hallazgo bien documentado en la babesiosis canina.

Estos resultados son similares a los obtenidos por Jain et al. (5353. Jain KJ, Lakshmanan B, Syamala K, Praveena JE, Aravindakshan T. High prevalence of small Babesia species in canines of Kerala, South India. Vet World. 2017;10(11):1319-1323. doi: 10.14202/vetworld.2017.1319-1323 ), quienes compararon los valores medios del Hto, el recuento total de eritrocitos y la concentración de hemoglobina con los valores de referencia reportados por Meinkoth et al. (5454. Meinkoth JH, Kocan AD, Loud SD, Lorenz M. Clinical and hematologic effects of experimental infection of dogs with recently identified Babesia gibsoni-like isolates from Oklahoma. Journal of the American Veterinary Medical Association. 2002;220(2):185-189.) y revelaron que la anemia y la trombocitopenia eran evidentes en las infecciones crónicas por B. gibsoni. Además, plantearon que las alteraciones hematológicas significativas y la posibilidad de no detectar los parásitos por la microscopía convencional, debido a la baja sensibilidad de este ensayo en las etapas iniciales de la enfermedad, exige el uso de un protocolo de PCR sensible para la detección rápida de la infección y la selección de opciones de tratamiento oportunas.

A pesar de que la leucopenia se considera como uno de los signos presentes en la babesiosis, específicamente para B. canis (2525. Furlanello T, Fiorio F, Caldin M, Lubas G, Solano-Gallego L. Clinicpathological findings in naturally occurring cases of babesiosis caused by large babesia from dogs of northeastern Italy. Vet Parasitol. 2005;134:77-85.), en el presente estudio solo tres animales positivos a Babesia spp. tenían leucopenia, lo que coincide con los resultados obtenidos por Ćoralić et al. (2020. Ćoralić A, Gabrielli S, Zahirović A, Stojanović NM, Milardi GL, Jažić A, et al. First molecular detection of Babesia canis in dogs from Bosnia and Herzegovina. Ticks Tick-borne Dis. 2018;9(2):363-368. ).

El estudio de asociación entre el sexo de los animales y la presencia de garrapatas con la infección por Babesia spp. mostró que no existe asociación entre las variables evaluadas para un valor de p=1 (Tabla 4).

 
Tabla 4.  Asociación de las variables en estudio con la presencia de Babesia spp. en perros callejeros de La Habana. / Association of the variables under study with the presence of Babesia spp. in stray dogs in Havana province.
PCR
Variables independientesCategoríasPositivosNegativosTotalPrueba exacta de Fisherp
Garrapatas625310.9211.000
No62329
Total124860
SexoFemenino726331.181.000
Masculino52227
Total124860

*Diferencias estadísticamente significativas (p<0,05).

 

Estos resultados concuerdan con los obtenidos por Singh et al. (5555. Singh A, Singh H, Singh N, Singh K, Rath S. Canine Babesiosis in Northwestern India: Molecular Detection and Assessment of Risk Factors. BioMed Res Int. 2014;741785. http://dx.doi.org/10.1155/2014/741785 ), pues no encontraron diferencias estadísticamente significativas (p≤0,05) entre el sexo y la infección por Babesia spp. en perros de la India. Estos autores plantean que existen otros factores de riesgo como la edad (animales jóvenes) y la época del año (verano) que sí influyen de forma directa en la presencia de Babesia spp. en perros.

En el caso de la infestación por garrapatas, Galay et al. (5656. Galay RL, Manalo AAL, Dolores SLD, Aguilar IPM., Sandalo KAC, Cruz KB, et al. Molecular detection of tick-borne pathogens in canine population and Rhipicephalus sanguineus (sensu lato) ticks from southern Metro Manila and Laguna, Philippines. Parasites Vectors. 2018;11:643. https://doi.org/10.1186/s13071-018-3192-y ) también reportaron que no existía asociación entre esta variable y la infección por Babesia spp. La garrapata R. sanguineus es nidícola y endófila, por lo que prefiere vivir en interiores en contacto cercano con su huésped. Los perros con hogar que viven en lugares con alta población de garrapatas tienen una mayor probabilidad de infestarse repetidamente que los perros callejeros que se mueven constantemente de un lugar a otro, lo que pudiera explicar los resultados encontrados en esta investigación. Cabe destacar que los perros callejeros pueden ser vehículos para las garrapatas y difundirlas; de esta manera contribuyen a la propagación de las hemoparasitosis, por lo que la prevención de la babesiosis canina, así como cualquier enfermedad transmitida por garrapatas, se logra eliminando la posibilidad de exposición al vector mediante un control activo del ambiente (5656. Galay RL, Manalo AAL, Dolores SLD, Aguilar IPM., Sandalo KAC, Cruz KB, et al. Molecular detection of tick-borne pathogens in canine population and Rhipicephalus sanguineus (sensu lato) ticks from southern Metro Manila and Laguna, Philippines. Parasites Vectors. 2018;11:643. https://doi.org/10.1186/s13071-018-3192-y ).

Las manifestaciones clínicas de la babesiosis canina varían con la especie del agente infeccioso, así como con la edad, el estado inmune y la fase de la enfermedad. B. rossi es altamente patogénica, provoca anemia hemolítica y complicaciones graves que incluyen signos neurológicos, fallo renal agudo y edema pulmonar. Las infecciones por B. vogeli son normalmente subclínicas en perros adultos, pero puede ser fatal en animales de tres a cuatro meses de edad. Las infecciones por B. canis, B. gibsoni y B. conradae cursan como enfermedad media a severa (4040. Solano-Gallego L, Baneth G. Babesiosis in dogs and cats-expanding parasitological and clinical spectra. Vet Parasitol. 2011;181:48-60.).

Frente a la posibilidad de hallazgos clínicos no característicos de una enfermedad en específico, se recomienda a los veterinarios considerar la parasitosis por Babesia spp. y realizar un análisis parasitológico seguido de la detección molecular y la determinación de las especies (5757. Caccio SM, Antunovic B, Moretti A, Mangili V, Marinculic A, Baric RR, et al. Molecular characterization of Babesia canis canis and Babesia canis vogeli from naturally infected European dogs. Vet. Parasitol. 2002;106:285-292.,5858. Duh D, Tozon N, Petrovec M, Strasek K, Avsic-Zupane T. Canine babesiosis in Slovenia: molecular evidence of Babesia canis canis and Babesia canis vogeli. Vet Res. 2004;35:363-368.).

Hasta donde los autores conocen, este es el primer estudio de detección Babesias pp. en perros sin dueño de Cuba y demuestra la necesidad de investigaciones futuras dirigidas a determinar la especie, con estudios adicionales sobre los vectores que la pueden transmitir.

 
 
 

 

REFERENCIAS
1. Gaunt SD, Beall M J, Stillman BA, Lorentzen L, Diniz P, Chandrashekar R, Breitschwerdt EB. Experimental infection and co-infection of dogs with Anaplasma platys and Ehrlichia canis: hematologic, serologic and molecular findings. Parasit Vectors.2010;3:33.
2. Hoskins JD. Ehrlichial diseases of dogs: diagnosis and treatment. Canine Pract. 1991;16:13-21.
3. Moreira SM, Bastos CV, Araújo RB, Santos M, Passos LMF. Retrospective study (1998-2001) on canine ehrlichiosis in Belo Horizonte, M G, Brazil. Arq Bras Med Vet Zootec.2003;55:141-147.
4. Aboge GO, Jia H, Terkawi MA, Goo Y, Kuriki K, Nishikawa Y, et al. A novel 57-kDa merozoite protein of Babesia gibsoniis a prospective antigen for diagnosis and serosurvey of canine babesiosis by enzyme-linked immunosorbent assay. Vet Parasitol. 2007;149:85-94.
5. Ikadai H, Tanaka H, Shibahara N, Matsuu A, Uechi M, Itoh N, et al. Molecular evidence of infections with Babesia gibsoni parasites in Japan and evaluation of the diagnostic potential of a loop-mediated isothermal amplification method. J Clin Microbiol. 2004;42:2465-2469.
6. Dantas-Torres F, Figueredo LA. Canine babesiosis: a Brazilian perspective. Vet Parasitol. 2006;141:197-203.
7. Eiras DF, Basabe J, Mesplet M, Schnittger L. First molecular characterization of Babesia vogeli in two naturally infected dogs of Buenos Aires, Argentina. Vet Parasitol. 2008;157:294-298.
8. Kelly PJ, Xu C, Lucas H, Loftis A, Abete J, Zeoli F, et al. Ehrlichiosis, babesiosis, anaplasmosis and hepatozoonosis in dogs from St Kitts. West Indies. PLoS One. 2013;8:e53450.
9. Irwin PJ, Hutchinson GW. Clinical and pathological findings of Babesia infection in dogs. AustVet J.1991;68:204-209.
10. Pérez B, Valdés R, Vitorte S. Epidemiología de las enfermedades trasmitidas por garrapatas en Cuba. Revista Cubana de Ciencias Ve terinarias. 2002;20:78-87.
11. Mylonakis ME, Koutinas AF, Billinis C, Leontides LS, Kontos V, Papadopoulos O, et al. Evaluation of cytology in the diagnosis of acute canine monocytic ehrlichiosis (Ehrlichia canis): a comparison between five methods. Vet Microbiol. 2003;91:197-204.
12. Ramos CA, Ramos RA, Araújo FR, GuedesJr D, Souza II, Ono TM, et al. Com paração de nested-PCR com o diagnóstico direto na detecção de Ehrlichia canis e Anaplasma platys em cães. Rev Bras Para sitol Vet. 2009;18:58-62.
13. González N, Dias C, Bezerra da S, Sandes P, Dias U, Cabezas- Cruz A, et al. Molecular detection of Ehrlichi acanis and Babesia canis vogeli in Rhipicephalus sanguineus sensu lato ticks from Cuba. Rev Bras MedVe t.2016;38(Supl.3):63-67.
14. Ettinger SJ, Feldman EC. Tratado de medicina interna veterinaria. 5 ed. ISBN 2910002278926. 2007.
15. Piratae S, Sae-chue B, Sukumolanan P, Phosri A. Molecular detection of blood pathogens and their impacts on levels of packed cell volume in stray dogs from Thailand. Asian Pac J Trop Dis. 2017;7(4):233-236.
16. Shoorijeh SJ, Ghasrodashti AR, Tamadon A, Moghaddar N, Behzadi MA. Seasonal frequency of ectoparasite infestation in dogs from Shiraz, Southern Iran. Turkish J Vet Anim Sci. 2008;32:309-313.
17. Nava S, Venzal JM, González-Acuña D, Martins TF, Guglielmone AA. Chapter 2 - Genera and Species of Ixodidae. En: Nava S, Venzal JM, González-Acuña D, Martins TF, Guglielmone AA, editor(es). In Ticks of the Southern Cone of America. Academic Press.2017:25-267.
18. Holbrook A, Johnson A, Madden P. Equine Piroplasmosis intraerithrocytic development of Babesia caballi (Nutall) and Babesia equi (Laveran). American J Vet Res. 1968;29(2):297.
19. Lempereur L, Beck R, Fonseca I, Marques C, Duarte A, Santos M, et al. Guidelines for the Detection of Babesia and Theileria Parasites. Vector borne and zoonotic diseases. 2017;17(1):doi:10.1089/vbz.2016.19552017.
20. Ćoralić A, Gabrielli S, Zahirović A, Stojanović NM, Milardi GL, Jažić A, et al. First molecular detection of Babesia canis in dogs from Bosnia and Herzegovina. Ticks Tick-borne Dis. 2018;9(2):363-368.
21. Birkenheuer AJ, Levy MG, Breitschwerdt EB.Development and evaluation of seminested PCR for detection and differentiation of Babesia gibsoni (Asian genotype) and B. canis DNA in canine blood samples. J Clin Microbiol. 2003;41:4172-4177.
22. Radostits MO, Mayhew GJ, Houston MD. Examen y diagnóstico clínico en veterinaria. EE.UU: Ediciones Harcourt, Saunders. 2002.
23. International Guiding Principles for Biomedical Research Involving Animals. Council for International Organization of Medical Sciences and the International Council for Laboratory Animal Science.2012.
24. Constantino C, Ferraz E, Paula A, Brandão D, Ferreira F, da Costa Vieira RF et AL. Survey of spatial distribution of vector-borne disease in neighborhood dogs in southern Brazil. Open Vet J. 2017;7(1):50-56.
25. Furlanello T, Fiorio F, Caldin M, Lubas G, Solano-Gallego L. Clinicpathological findings in naturally occurring cases of babesiosis caused by large babesia from dogs of northeastern Italy. Vet Parasitol. 2005;134:77-85.
26. Buckner RG, Ewing SA. Canine Babesiosis. In: Kirk R W (ed) Current Veterinary Therapy V. Saunders, Philadelphia. 1974.
27. Mandal A. Leukopenia and leukocitosis [en línea]. EEUU. 2013. http://www.news-medical.net
28. Szabó JMP, Marquez CT, Pinter A, Vicentini F.Ticks (Acari: Ixodidae) Associated with Domestic Dogs in Franca Region, São Paulo, Brazil. Exp Appl Acarol. 2001:25: 909-916. https://doi.org/10.1023/A:1020433003028
29. Rodriguez-Vivas RI, Apanaskevich DA, Ojeda-Chi MM.,et al. Ticks collected from humans, domestic animals, and wildlife in Yucatán, Mexico. Vet Parasitol. 2016;215:106-113.
30. Yabsley MJ, McKibben J, Macpherson CN, et al. Prevalence of Ehrlichia canis, Anaplasma platys, Babesia canis vogeli, Hepatozoon canis, Bartonella vinsonii berkhoffii, and Rickettsia spp. in dogs from Grenada. Vet Parasitol. 2008;151:279-285.
31. Asgarali Z, Pargass I, Adamb J, Mutani A, Ezeokoli C. Haematological parameters in stray dogs seropositive and seronegative to Ehrlichia canis in North Trinidad. Ticks Tick Borne Dis. 2012;3(4):207-211.
32. Loftis AD, Kelly PJ, Freeman MD, Fitzharris S Beeler-Marfisi J, Wang C. Tick-borne pathogens anddisease in dogs on St. Kitts, West Indies. Vet Parasitol.2013;196:44-49.
33. Starkey LA, Newton K, Brunker J, Crowdis K, Edourad EJP, Meneus P, et al. Prevalence of vector-borne pathogens in dogs from Haiti. Vet Parasitol. 2016;224:7-12.
34. Barros-Battesti DM, Hernández MR, Famadas KM, Onofrio VC, Beati L, Guglielmone AA. The ixodid ticks (Acari: Ixodidae) of Cuba. Syst App lAcarol. 2009;14:101-128.
35. Dantas-Torres F, Otranto D. Further thoughts on the taxonomy and vector role of Rhipicephalus group ticks. Vet Parasitol. 2015;208:9-13.
36. Ueti MW, Palmer GH, Scoles GA, Kappmeyer LS, Knowles DP. Persistently Infected Horses Are Reservoirs for Intrastadial Tick-Borne Transmission of the Apicomplexan Parasite Babesia equi. Infection Immun. 2008;76:3525-3529.
37. Schoeman JP. Canine babesiosis. Onderstepoort J Vet. Res. 2009;76:59-66.
38. Izzi SA, Martin DS, Chan RYY, Leutenegger CM. Babesia canis vogeli, Ehrlichia canis, and Anaplasma platys infection in a dog. Vet Clin Pathol. 2013;42(4):471-475.
39. Solano-Gallego L, Sainz Á, Roura X, Estrada-Peña A, Miró G. A review of canine babesiosis: the European perspective. Parasit Vectors. 2016;9:336.
40. Solano-Gallego L, Baneth G. Babesiosis in dogs and cats-expanding parasitological and clinical spectra. Vet Parasitol. 2011;181:48-60.
41. Baneth G, Florin-Christensen M, Cardoso L, Schnittger L. Reclassification of Theileria annae as Babesia vulpes sp. Nov. ParasitVectors.2015;8:207.
42. Miró G, Checa R, Paparini A, Ortega N, González-Fraga JL, Gofton A, et al. Theiler iaannae (syn. Babesia microti-like) infection in dogs in NW Spain detected using direct and indirect diagnostic techniques: clinical report of 75 cases. Parasites and Vectors.2015;8:217.
43. Amritpal S, Harkirat S, Singh NK, Singh ND, Rath SS.Canine Babesiosis in Northwestern India. Molecular Detection and Assessment of Risk FactorsBioMed Res Internat. 2014;(74):5.
44. Karunakaran S, Pillai UN, Sasidharan HP. Babesia gibsoni infection in a German shepherd dog. Vet World. 2011;4:269-270.
45. Quiroz R. Parasitología y enfermedades parasitarias de animales domésticos. México. Limusa. 1984; p. 876.
46. Augustine S, Sabu L, Lakshmanan B. Molecular identification of Babesia spp. in naturally infected dogs of Kerala, South India. J Parasit Dis. 2017;41(2):459-462. DOI 10.1007/s12639-016-0827-9.
47. Allsopp M, Allsopp B. Molecular sequence evidence for the reclassification of some Babesia species. Ann N Y Acad Sci. 2006;1081:509-517.
48. Hurtado A. Reverse line blot hybridization with species-specific oligonucleotide probes: Application to piroplasm detection. Methods Mol Biol. 2015;12(47):183-192.
49. Michelet L, Delannoy S, Devillers E, Umhang G, et al.High-throughput screening of tick-borne pathogens in Europe. Front Cell Infect Microbiol. 2014;4:103.
50. Bonnet S, Michelet L, Moutailler S, Cheva J, Hébert C, Vayssier-Taussat M, et al. Identification of parasitic communities within European ticks using next-generation sequencing. PLoS. Negl. Trop. Dis. 2014;8:e2753.
51. O’Dwyer LH, Lopes VVA, Rubini AS, Paduan KDS, Ribolla PEM. Babesia spp. infection in dogs from rural areas of Sao Paulo State Brazil. Rev Bras Parasitol Vet Jaboticabal.2009;18:23-26.
52. Avinash KB, Ghanshyam CM, Falguni BT. Clinicopathological alterations in naturally occurring Babesia gibsoni infection in dogs of Middle-South Gujarat, India. Vet World. 2017;10(10):1227-1232. doi: 10.14202/vetworld.2017.1227-1232
53. Jain KJ, Lakshmanan B, Syamala K, Praveena JE, Aravindakshan T. High prevalence of small Babesia species in canines of Kerala, South India. Vet World. 2017;10(11):1319-1323. doi: 10.14202/vetworld.2017.1319-1323
54. Meinkoth JH, Kocan AD, Loud SD, Lorenz M. Clinical and hematologic effects of experimental infection of dogs with recently identified Babesia gibsoni-like isolates from Oklahoma. Journal of the American Veterinary Medical Association. 2002;220(2):185-189.
55. Singh A, Singh H, Singh N, Singh K, Rath S. Canine Babesiosis in Northwestern India: Molecular Detection and Assessment of Risk Factors. BioMed Res Int. 2014;741785. http://dx.doi.org/10.1155/2014/741785
56. Galay RL, Manalo AAL, Dolores SLD, Aguilar IPM., Sandalo KAC, Cruz KB, et al. Molecular detection of tick-borne pathogens in canine population and Rhipicephalus sanguineus (sensu lato) ticks from southern Metro Manila and Laguna, Philippines. Parasites Vectors. 2018;11:643. https://doi.org/10.1186/s13071-018-3192-y
57. Caccio SM, Antunovic B, Moretti A, Mangili V, Marinculic A, Baric RR, et al. Molecular characterization of Babesia canis canis and Babesia canis vogeli from naturally infected European dogs. Vet. Parasitol. 2002;106:285-292.
58. Duh D, Tozon N, Petrovec M, Strasek K, Avsic-Zupane T. Canine babesiosis in Slovenia: molecular evidence of Babesia canis canis and Babesia canis vogeli. Vet Res. 2004;35:363-368.
 
 

Recibido: 04/11/2021

Aceptado: 12/03/2021

 
 

Conflicto de Intereses: Los autores declaran que no existen conflictos de intereses relacionados con el presente artículo.

Los autores Lisset Roblejo-Arias y Cristian Díaz-Corona tuvieron la misma contribución.

Contribución de los autores: Lisset Roblejo-Arias: participó en el diseño y ejecución de los experimentos, en el análisis de los resultados y en la escritura del documento. Cristian Díaz-Corona: participó en el diseño y ejecución de los experimentos, en el análisis de los resultados y en la escritura del documento. Adrian Alberto Díaz-Sánchez: participó en el diseño y ejecución de los experimentos y en el análisis de los resultados. Evelyn Lobo-Rivero: participó en la escritura y revisión del documento. Roxana Marrero-Perera: participó en la realización de los experimentos. Elianne Piloto Sardiñas: participó en la realización de los experimentos. Belkis Corona-González: participó en el diseño de los experimentos y en la escritura y revisión del documento. Ernesto Vega-Cañizares: participó en el diseño y realización de los experimentos y en la escritura y revisión del documento. Todos los autores revisaron y aceptaron la versión final del documento.

 

Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons


 

Enlaces refback

  • No hay ningún enlace refback.